ID: 975253386

View in Genome Browser
Species Human (GRCh38)
Location 4:72206063-72206085
Sequence GGTAAGAGTTTAAATAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975253381_975253386 30 Left 975253381 4:72206010-72206032 CCAGGAATGTGGAATTTCATGGC No data
Right 975253386 4:72206063-72206085 GGTAAGAGTTTAAATAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975253386 Original CRISPR GGTAAGAGTTTAAATAACTA TGG Intergenic