ID: 975253386 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:72206063-72206085 |
| Sequence | GGTAAGAGTTTAAATAACTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 975253381_975253386 | 30 | Left | 975253381 | 4:72206010-72206032 | CCAGGAATGTGGAATTTCATGGC | No data | ||
| Right | 975253386 | 4:72206063-72206085 | GGTAAGAGTTTAAATAACTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 975253386 | Original CRISPR | GGTAAGAGTTTAAATAACTA TGG | Intergenic | ||