ID: 975256332

View in Genome Browser
Species Human (GRCh38)
Location 4:72240057-72240079
Sequence AAGATTAAACAAAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975256329_975256332 18 Left 975256329 4:72240016-72240038 CCAACAGGAAGGTAGAGGTAGCA No data
Right 975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975256332 Original CRISPR AAGATTAAACAAAAGGAAGG AGG Intergenic
No off target data available for this crispr