ID: 975259210

View in Genome Browser
Species Human (GRCh38)
Location 4:72276419-72276441
Sequence AAATTCCTGCTGTCCTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975259210_975259211 25 Left 975259210 4:72276419-72276441 CCTCTATAGGACAGCAGGAATTT No data
Right 975259211 4:72276467-72276489 TAAGCACCTAGAATGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975259210 Original CRISPR AAATTCCTGCTGTCCTATAG AGG (reversed) Intergenic
No off target data available for this crispr