ID: 975259330

View in Genome Browser
Species Human (GRCh38)
Location 4:72277880-72277902
Sequence TCTTATATGCCAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975259330_975259342 29 Left 975259330 4:72277880-72277902 CCTTCTTCCCTTGGCATATAAGA No data
Right 975259342 4:72277932-72277954 AAGGCTGTCATCAAGAGAAGAGG No data
975259330_975259333 -3 Left 975259330 4:72277880-72277902 CCTTCTTCCCTTGGCATATAAGA No data
Right 975259333 4:72277900-72277922 AGACCAAGAGCCCCTTCTCCAGG No data
975259330_975259338 10 Left 975259330 4:72277880-72277902 CCTTCTTCCCTTGGCATATAAGA No data
Right 975259338 4:72277913-72277935 CTTCTCCAGGTCCCAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975259330 Original CRISPR TCTTATATGCCAAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr