ID: 975260606

View in Genome Browser
Species Human (GRCh38)
Location 4:72293221-72293243
Sequence CAGTGTGAGCTGTGAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975260606 Original CRISPR CAGTGTGAGCTGTGAAAACA AGG Intronic
900350343 1:2231451-2231473 CTGTGTCAGCTGTGACAACGAGG - Intronic
901167070 1:7228854-7228876 CAGTGTGTGCTGTGACACCAAGG + Intronic
902472365 1:16657621-16657643 CAGTGTGAGCTCAGAAAGCCTGG + Intergenic
902486439 1:16749825-16749847 CAGTGTGAGCTCAGAAAGCCTGG - Intronic
903351935 1:22722509-22722531 CACTGGGAGGTGTTAAAACATGG + Intronic
906666872 1:47628198-47628220 CAGAGTGGGCTCTGAACACAAGG - Intergenic
909342775 1:74550271-74550293 CTGTGTGACCTGTGCAAACATGG + Intergenic
910477004 1:87618138-87618160 AAGTGTGATATGTGAAAAGAAGG + Intergenic
911717757 1:101154054-101154076 CAGAGGGAGCTGTGACATCAAGG + Intergenic
913443010 1:118919142-118919164 CTGTGTTACCTGGGAAAACAAGG + Intronic
916901098 1:169224589-169224611 CAATATGAGTGGTGAAAACAAGG + Intronic
917251091 1:173061697-173061719 CAGTGGGATCTGGGAACACATGG - Intergenic
918040098 1:180908678-180908700 CCATGTGAGCTGTGGAAACCAGG - Intergenic
918081755 1:181213270-181213292 CTGTCTGAACTGTGAAACCATGG + Intergenic
918422965 1:184382740-184382762 CAGTGTTAGCTGTGATTGCATGG + Intergenic
922088861 1:222376639-222376661 CAGGGAGAGCTGTGAGAAGATGG - Intergenic
922617642 1:226972354-226972376 AAATTTGACCTGTGAAAACAAGG + Intronic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923573347 1:235136271-235136293 CAGTGCCAGCTGTGAACAAAAGG - Intronic
924525575 1:244844797-244844819 CAGTGCGGCCTCTGAAAACATGG - Exonic
1062855324 10:777278-777300 CAGCGTGTGCTGTGACACCAAGG + Intergenic
1066025550 10:31355742-31355764 CAGTGTGAGCGTTGAAAAGAAGG + Intronic
1067722233 10:48736855-48736877 CAGTCAGAGGTGTGGAAACACGG + Intronic
1067816981 10:49486874-49486896 CTGTGTCAGTTTTGAAAACAGGG - Intronic
1068818253 10:61343013-61343035 GAGCGAGAGCTGTGTAAACAGGG + Intergenic
1068873090 10:61966366-61966388 CACTGTGAGCTGGAAACACAGGG - Intronic
1070780481 10:79134749-79134771 CACTATGATCTGTGAAATCATGG - Intronic
1070921310 10:80188161-80188183 GAGTGTGGGCCGTGAAAAGATGG - Intronic
1071051871 10:81460126-81460148 CAGCTTGAGCCGTAAAAACACGG - Intergenic
1075004748 10:118821859-118821881 CAGTTTGATCTGTACAAACAAGG - Intergenic
1076645417 10:131950840-131950862 CTTTGTGAGCTCTGGAAACAAGG + Intronic
1077436092 11:2539905-2539927 CAGGGTCAGATGTGAAAACAAGG - Intronic
1078716797 11:13847387-13847409 CAGTGGGGACTGTGAAGACAGGG + Intergenic
1078914953 11:15770456-15770478 GAGTGTGAGATGTGGAAACCTGG - Intergenic
1079410115 11:20179631-20179653 CAGTTTGAGCTTAGTAAACAGGG - Intergenic
1079880180 11:25917990-25918012 TACTGTGATCTGTTAAAACAGGG - Intergenic
1081034827 11:38130881-38130903 CAGTGTATGCTTTTAAAACAAGG + Intergenic
1082219869 11:49621581-49621603 CAGTGAGACCTGTGAGAGCAAGG + Intergenic
1086419299 11:86622611-86622633 CAGTGTGAAGTGGGAAAACCAGG - Intronic
1086629757 11:89003196-89003218 CAGTGAGACCTGTGAGAGCAAGG - Intronic
1087871509 11:103299249-103299271 CAGATTGAGCTATGAAAGCAGGG - Intronic
1089641685 11:119851816-119851838 CAGTGCAAGCTGAGAGAACAGGG - Intergenic
1090103050 11:123822266-123822288 CAGTGTGATCTGAGATCACAGGG - Intergenic
1090439875 11:126716604-126716626 CACTGTGGCCTGTGAAAACCTGG + Intronic
1090614415 11:128502159-128502181 CAGTTGGAGCTGTGCATACAGGG - Intronic
1092818555 12:12332062-12332084 CAGTTTGAGCTGTGATAAATGGG - Intronic
1092854621 12:12661500-12661522 ATGTGATAGCTGTGAAAACAAGG + Exonic
1093428230 12:19053599-19053621 CAGGGTGATCTGTGAGTACAAGG - Intergenic
1097018727 12:56005234-56005256 AAGTGTGAGCTGTTACAGCAAGG + Exonic
1097623362 12:61968632-61968654 CAGAGTAAGCTGTCAAAAAATGG - Intronic
1097691576 12:62739091-62739113 CAGTGGAAGCTGTGAGAAAATGG + Intronic
1098522401 12:71448142-71448164 CAGTGTAGGCTTTGAAAAGAAGG - Intronic
1102196749 12:111031337-111031359 CAGTGTGTTCTCTAAAAACAAGG + Intergenic
1103368965 12:120403778-120403800 CACTGAGAGGTGTGACAACAAGG - Intergenic
1103913706 12:124365336-124365358 AGGTGAGAGCTGTGACAACAGGG + Intronic
1104624865 12:130343439-130343461 CAGTGAGAGATGACAAAACAGGG - Intronic
1107270615 13:38611660-38611682 CAGTCTGACATTTGAAAACATGG + Intergenic
1107513811 13:41109800-41109822 CAGTGGAAACTGTGAGAACATGG - Intergenic
1107735004 13:43390013-43390035 CAGTGTGAGTGCTGAAAACGAGG + Intronic
1107875546 13:44787826-44787848 CAGAGTGAACTATGAAAACCAGG - Intergenic
1108251766 13:48574610-48574632 CAGTGGGAGCTGTGACAGGAAGG + Intergenic
1108583239 13:51845299-51845321 CCCTGGGAGCTGTGGAAACATGG + Intergenic
1110323937 13:74192540-74192562 TAGTGTGAGATGTGATTACAAGG + Intergenic
1111396721 13:87675571-87675593 AACTGTGAGCTGTGAAAACCGGG + Exonic
1111762178 13:92480296-92480318 TTATGTGAGCTGTGTAAACAAGG - Intronic
1113173209 13:107530041-107530063 AAGAGTGAGCTGTGGAAAGAAGG - Intronic
1113385768 13:109846514-109846536 CAGTGGGAGCTGAGAAAACTGGG + Intergenic
1117460539 14:55940550-55940572 AAGTGTGAAGTGTGAAAAGAGGG + Intergenic
1121102609 14:91260414-91260436 CAGTGTGTCCTGTGACTACAAGG + Intergenic
1121402464 14:93692019-93692041 AACTGAGATCTGTGAAAACAGGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1202881499 14_KI270722v1_random:65172-65194 CAGTGGTAGCTGGGAAAACTTGG + Intergenic
1124719032 15:32095832-32095854 CAGTGTTTGCTGTTACAACAAGG + Intronic
1125437834 15:39667034-39667056 CAGTGGGCGCTGTGAAAAGATGG + Intronic
1125715883 15:41819694-41819716 CAAAGGGAGCTGTGAGAACAGGG + Intronic
1132330526 15:101009262-101009284 CCGGGTGAGCTGTGTAAACTTGG - Intronic
1133919941 16:10143184-10143206 CTGTCTGGGTTGTGAAAACAAGG + Intronic
1134230959 16:12430094-12430116 CATTGTGAACTGTGCATACAAGG + Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1135895393 16:26396431-26396453 AAGGGTGAGCTGTGGAAAGAAGG - Intergenic
1136448305 16:30337359-30337381 CAGTGTGTCCTGTGCGAACACGG - Intergenic
1137062989 16:35809214-35809236 CAGTGCTAGCTGTGAACACCAGG + Intergenic
1138011723 16:53387037-53387059 CAGTGTTAACTGTGAACACCTGG + Intergenic
1138403849 16:56772244-56772266 AAGTGTTAGCTGTGAAAACACGG + Intronic
1138967337 16:62100435-62100457 CAGGGTGAGATGTGGTAACATGG + Intergenic
1140287499 16:73618495-73618517 CATTATGAGCTGTGGAAACTTGG - Intergenic
1141071740 16:80962676-80962698 GAGTGTGAGATTTGAAAACCTGG - Intergenic
1141213531 16:82003070-82003092 CAGTGTGACAAGTGAAGACAAGG + Intronic
1141354119 16:83327638-83327660 CAATAAGAGCCGTGAAAACAAGG + Intronic
1141962399 16:87417855-87417877 CAGGGTGGCCTGTGACAACAGGG - Intronic
1147581964 17:41632026-41632048 GAGGGTCGGCTGTGAAAACACGG + Intergenic
1149028302 17:52055468-52055490 TAGTGTGATATCTGAAAACAAGG + Intronic
1152373607 17:79906036-79906058 CAGTAAGAGCTGTCAAAACGAGG - Intergenic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1153520381 18:5947180-5947202 CAATGTGACCTGTGATAACATGG - Intergenic
1155317932 18:24590934-24590956 GAGTGTGATCTCTGCAAACAGGG - Intergenic
1160829782 19:1098379-1098401 CCCTGTGAGCAGTGAAAAGAGGG + Intergenic
1161723289 19:5915207-5915229 CAGTGTGACCTGGGAACAGAGGG - Exonic
1164904093 19:31952872-31952894 CTGTGTGGGCTGTGAACGCAGGG - Intergenic
1167632668 19:50635301-50635323 CAGGTTGAGTTGAGAAAACAGGG + Intronic
1168609832 19:57790276-57790298 CAGTGTGACCTTTGAAGACGTGG + Intronic
925865266 2:8221428-8221450 CAGTGTGGGCTGTGCACAGAGGG - Intergenic
926401960 2:12506215-12506237 GTGTGTGAGCTGTGAAAAACAGG - Intergenic
926729889 2:16028667-16028689 CACTGTGGGCTGCGAAAACCTGG + Intergenic
926829968 2:16950923-16950945 CAGTGTGAGTTTTCAAAGCAGGG - Intergenic
927416892 2:22889404-22889426 GTGTGTGACCTGTGCAAACAAGG - Intergenic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929847362 2:45543604-45543626 AAGTGTAAGATGAGAAAACATGG + Intronic
930198561 2:48531311-48531333 AAAAGGGAGCTGTGAAAACAAGG + Intronic
932095013 2:68839627-68839649 CAGTGTGAGTTTGAAAAACAGGG + Intergenic
934514484 2:94977689-94977711 CAGTGAGAGGAGTGAACACAGGG - Intergenic
935005103 2:99066815-99066837 CAGAGGGAGCTGTGGATACAGGG - Intronic
935264781 2:101384925-101384947 CAGTGTGTGCAGTGATCACATGG - Intronic
937117625 2:119419932-119419954 CAGTGTGTGCTGAGATCACATGG + Intergenic
937768516 2:125690591-125690613 CAGTGTGTTCTGTTATAACAAGG + Intergenic
938875724 2:135530259-135530281 CAGTTTGAACTGTAAAGACAGGG - Intronic
939181663 2:138810175-138810197 CAGTGTGAGCTCTAATGACATGG + Intergenic
941684348 2:168432879-168432901 CACTGGGGGCTGTGAAAACAAGG - Intergenic
942161400 2:173192049-173192071 CAGTATGAGATGTAAAGACAGGG - Intronic
942164286 2:173226822-173226844 GAGTGTGAGCTTTGAATAGATGG + Intronic
943193929 2:184718880-184718902 CTGCTTGAGCTGTGAAAAGAGGG - Intronic
944579000 2:201116290-201116312 CAGTGACAGCTGAGACAACAAGG + Exonic
945338416 2:208619969-208619991 CACTATGAGCTGGGATAACAGGG + Intronic
946328019 2:218994709-218994731 CAGAGTGAGCTGGGAAAAGGCGG + Intergenic
946805074 2:223463551-223463573 CATTTGGAGCTGTGAAAAGAGGG + Intergenic
948204531 2:236156275-236156297 CAGTGTCAGCTGTGAAACCCGGG + Intergenic
948209574 2:236182818-236182840 CAGTGTGAACTGTGTAAGAAAGG + Intergenic
1171328101 20:24313627-24313649 CAGTGTGGGCTGTGCTCACAGGG + Intergenic
1175219394 20:57408327-57408349 CAGTCTGAGGTGTGAGGACACGG + Exonic
1175280521 20:57801201-57801223 CAGGCTGAGCTGTGACAACAGGG - Intergenic
1175626185 20:60489875-60489897 CAGTGTGCCCTTTGAAAAGATGG + Intergenic
1176955240 21:15094985-15095007 CAGTATAAGCTGTTAATACAAGG - Intergenic
1178757587 21:35366820-35366842 TAGTTTGAGCTGTGATAACGTGG - Intronic
1180837587 22:18938082-18938104 CACAGTGAGCTGTGATCACATGG - Intergenic
1181261235 22:21599360-21599382 CAGTGTGCCCTCAGAAAACAGGG - Intronic
1181779738 22:25184032-25184054 CACTGTGCTCTGTGAAAACGGGG + Intronic
1185024548 22:48400954-48400976 CAGTGTGAGGAGTAAAAACTGGG + Intergenic
1203287680 22_KI270734v1_random:163381-163403 CACAGTGAGCTGTGATCACATGG - Intergenic
950524506 3:13516203-13516225 CAGTTTGAGCTGAGGAAACTGGG - Intergenic
950677195 3:14561447-14561469 CTGTGTGACCTTTGACAACAGGG - Intergenic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
951496235 3:23330240-23330262 CATTTAGAGCTGTGAAAAGAGGG - Intronic
951590996 3:24264501-24264523 CATTGTCAGCTGGGAAAACAAGG - Intronic
954272960 3:49523830-49523852 CAGTGTCATCTGTAAAATCAGGG - Intronic
954505699 3:51070702-51070724 CAGTATCAGCTGAGAAAAGATGG - Intronic
955044376 3:55346207-55346229 CATCATGAGCTGTGAAAACGTGG + Intergenic
956117774 3:65935714-65935736 CTGTGTGAGCTCTGAAGAAAGGG + Intronic
957579437 3:82051826-82051848 CTGTGTGTGCTGTGAAAAAGTGG + Intergenic
958757151 3:98262951-98262973 CAGTGTGAGCTGTCAAATTATGG - Intergenic
959270575 3:104204112-104204134 CAGCTTGAGTTGAGAAAACAAGG - Intergenic
961092997 3:124131638-124131660 CAGTGGCAGCTGTGACATCAGGG + Intronic
961093641 3:124136778-124136800 GAGTGTGACCTGGGAAAAGATGG + Intronic
961371401 3:126434040-126434062 CAGTGGGAGCTCTGAGAACATGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
964392365 3:156211092-156211114 GAGTGTGGGCAGTGAAAAAAGGG + Intronic
967080975 3:186049125-186049147 CAGTGACAGCTTTGAAAGCATGG + Intronic
967551884 3:190805695-190805717 CACTTTTAGCTGTGCAAACATGG + Intergenic
968865050 4:3203700-3203722 CAGTGTGAGTTCTGAAATAAAGG + Intronic
969407278 4:7001924-7001946 CGGTCTGAGCTGTGGAAAGACGG + Intronic
969718708 4:8881275-8881297 CAGGGTGAGGTGTGTATACAGGG - Intergenic
970088984 4:12381820-12381842 CAATGTCAGCTGTGAAAATAAGG + Intergenic
970534571 4:17017141-17017163 CAGTGTAAGTTGGGAAAAAAAGG - Intergenic
972712351 4:41610026-41610048 CAGTTTGAACAGTGAAAACCAGG - Intronic
973580879 4:52342972-52342994 CAGTGTAAGTTGTGAAAGGAAGG - Intergenic
974285983 4:59867883-59867905 CAGTGTGAGAATTGAATACAGGG + Intergenic
974710502 4:65587811-65587833 CAGTCTGAGGTCTGAAAATAGGG + Intronic
975260606 4:72293221-72293243 CAGTGTGAGCTGTGAAAACAAGG + Intronic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
976012470 4:80507628-80507650 CAGCAGTAGCTGTGAAAACAGGG - Intronic
976824260 4:89242319-89242341 CAGCTTTAGCTGTGAAAAAATGG - Exonic
978554022 4:109959257-109959279 CAGTGTCCTCTGTCAAAACACGG + Intronic
979297909 4:119054072-119054094 CACAGTGAGCTGAGTAAACAGGG - Intronic
982222498 4:153137004-153137026 GAGTCTGAGCTGTGAAAGAAAGG + Intergenic
982753105 4:159186093-159186115 CAATGTGATCTGGTAAAACAAGG + Intronic
982940068 4:161539309-161539331 CAGTGTGGTTTGGGAAAACAAGG + Intronic
984126086 4:175812667-175812689 CAGGCTGAGCTGTGAACAGATGG + Intronic
984313118 4:178090205-178090227 CAGTTTGAGCTATAAAAACCTGG + Intergenic
986273264 5:6252396-6252418 CAGTGTGAGCTATGCCTACAGGG - Intergenic
987256110 5:16153309-16153331 CGGTTTGTGCTGTGAAAACAAGG + Intronic
987477521 5:18409843-18409865 CAGTGTCAGCTGAGATCACATGG + Intergenic
987836358 5:23168353-23168375 CATTGTGAACTGTGCATACAAGG + Intergenic
991582131 5:68167300-68167322 AAGTCTGAGCTGGGAAAACATGG + Intergenic
991605083 5:68393104-68393126 GAGTGTGAGCTTTGAATACAAGG + Intergenic
992348358 5:75903667-75903689 TAATCTGAGCTGTGAGAACAAGG - Intergenic
993731657 5:91429939-91429961 CACTGTCACCTATGAAAACATGG - Intergenic
993832225 5:92774778-92774800 CAGTGTCAGCTGTGAAACACTGG + Intergenic
995179300 5:109215344-109215366 CTGTGTGAGCTGTCCAAACTAGG - Intergenic
995349968 5:111163901-111163923 CAGTGTGTGCAGAGATAACATGG + Intergenic
997379771 5:133427300-133427322 CTGTGGGAGCTGATAAAACAAGG - Intronic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
997919337 5:137963800-137963822 TATTGTGAGCTGTGCAAACAAGG + Intronic
998079265 5:139261157-139261179 GAGTATGTGCTGTGAAGACAGGG - Intronic
998681727 5:144475061-144475083 CAGTAAGAACTCTGAAAACATGG - Exonic
999458361 5:151736819-151736841 GAGTGGAAGCTGAGAAAACATGG - Intergenic
999668093 5:153934363-153934385 TACTGGGAGCTGTGAGAACAGGG - Intergenic
1001717236 5:173826256-173826278 GAGTGTCAGCTGGAAAAACAAGG + Intergenic
1003738019 6:8899900-8899922 TGGTGCGAGCTCTGAAAACAGGG + Intergenic
1004291450 6:14371042-14371064 CAGTGTGACTGGTGAAAATAGGG + Intergenic
1004538642 6:16527517-16527539 GAGTCTGATCTGTGAAACCAAGG + Intronic
1004943263 6:20584348-20584370 CAGTGTGTTCTGAGAAAGCAGGG + Intronic
1006623033 6:35380312-35380334 CACTGTGAGATGTGGAACCACGG - Intronic
1010393142 6:75359537-75359559 CAATGAGAGATGTGAAATCAAGG - Intronic
1012873768 6:104701155-104701177 CACTGTGAGCTCTCAATACATGG - Intergenic
1014107497 6:117583244-117583266 CAGGGTGGGCTGAGTAAACAGGG + Intronic
1017976642 6:159363764-159363786 AAGTGTCCACTGTGAAAACAAGG + Intergenic
1018598671 6:165514507-165514529 CACTGGGAGCTGTGAAGAGATGG + Intronic
1018844497 6:167546506-167546528 CAGTGTGAGCTTAGAAATTAGGG - Intergenic
1018910177 6:168097236-168097258 CAGTGTGAGCTGTGTTATAATGG - Intergenic
1020231711 7:6324211-6324233 GAGGGTGAGCTGAGAAAAGAGGG - Intergenic
1022803047 7:33793890-33793912 CAGTCTTATCTGTGAAATCAAGG - Intergenic
1023234024 7:38065236-38065258 CAGGGTAAGCTGTGTAAAAACGG + Intergenic
1023876240 7:44287787-44287809 CTGTGTGAGCTGGGAAAGCGGGG - Intronic
1025721901 7:64024787-64024809 AATTGTGAGCTGTGTACACATGG - Intergenic
1028267749 7:88748596-88748618 CAGTGATAGCTGAGAACACATGG - Intergenic
1028335642 7:89651201-89651223 CAGAGTGAACTGTGAATAAAAGG - Intergenic
1030297935 7:107947572-107947594 CAGTGTGGCCTGTGAAGGCAGGG - Intronic
1032098800 7:128955611-128955633 CTGAGTGTGCTGTGGAAACAAGG + Intronic
1032981710 7:137291717-137291739 CAGTAGGAGCTTTGAAAAAATGG - Intronic
1033422671 7:141217383-141217405 CAGAGGAAGCTGAGAAAACAGGG + Intronic
1035736360 8:1890109-1890131 CCGTGTGAGTTGTGAGAAAACGG + Intronic
1038401864 8:27289721-27289743 CAGTCAGAGCTGTGCAAAGATGG - Intronic
1041437748 8:57861147-57861169 CAGGGCGAGCTGTCCAAACATGG - Intergenic
1042031254 8:64478393-64478415 CAGTTTGTGCAATGAAAACAGGG + Intergenic
1042294596 8:67205544-67205566 AAGTCTGACCTCTGAAAACAGGG + Intronic
1042674593 8:71306069-71306091 CAGTGAGAGCTGTGACACCTGGG - Intronic
1043287741 8:78555619-78555641 CAGTTTGAGATCAGAAAACAGGG - Intronic
1043663499 8:82777589-82777611 CAGTGTAAACTGTGAAACGATGG + Intergenic
1043912451 8:85878623-85878645 CAGTGTGAGAAGTGCTAACATGG - Intergenic
1046816134 8:118585852-118585874 CACTGTGAGCAGAGAAAACAAGG - Intronic
1048334396 8:133491984-133492006 CAGTGGGAGGAGCGAAAACATGG + Intronic
1049303535 8:141884555-141884577 CACTGAGAGCCCTGAAAACAGGG - Intergenic
1055630062 9:78214677-78214699 CCTTGTGAGCTGTGGCAACAAGG + Intergenic
1056170621 9:83980917-83980939 GAGTGTGGGCTGTGAAAACACGG - Exonic
1056874013 9:90310389-90310411 CAGAGTCAGCTGTGCACACACGG + Intergenic
1058533171 9:105927169-105927191 CACTGTGAAGTATGAAAACAGGG - Intergenic
1058847517 9:108975586-108975608 TAGTTGGAGCTGGGAAAACAGGG + Intronic
1060148900 9:121274522-121274544 CAGTGACACTTGTGAAAACACGG + Intronic
1062368699 9:136225251-136225273 TAGCGTTAGCTGTGACAACACGG + Intronic
1186306169 X:8260979-8261001 AAGTGGGAGCTGGGAACACATGG + Intergenic
1186410367 X:9340974-9340996 CTGTGTGGGCTTTGAAAATAGGG - Intergenic
1187891518 X:23940380-23940402 CAGTACAAGCTCTGAAAACAAGG - Intergenic
1192070659 X:67937012-67937034 CCATGTGAGATGTAAAAACAAGG + Intergenic
1193697208 X:84723827-84723849 CACTGTGACCTGTGCAAGCAGGG - Intergenic
1193897148 X:87128100-87128122 CAAGGTGATCTGGGAAAACATGG + Intergenic
1196763228 X:119219028-119219050 CATTGTGAGCCTGGAAAACAAGG - Intergenic
1199879711 X:151964275-151964297 CAATGTCAGCTCTGGAAACAGGG - Intronic
1200140865 X:153902370-153902392 CAGTGGGAGGTGTGCACACAGGG + Intronic
1202129671 Y:21598274-21598296 CAGTCTGAGGTGTGAGAATACGG - Intergenic
1202191645 Y:22252032-22252054 GAGTGTGAGATAAGAAAACAAGG + Intergenic