ID: 975262786

View in Genome Browser
Species Human (GRCh38)
Location 4:72323551-72323573
Sequence TGGCTATGGGGTCTGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975262780_975262786 9 Left 975262780 4:72323519-72323541 CCAGGGGTGCTACGTCTGGTTGA 0: 1
1: 0
2: 0
3: 7
4: 41
Right 975262786 4:72323551-72323573 TGGCTATGGGGTCTGTGTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 246
975262778_975262786 21 Left 975262778 4:72323507-72323529 CCTGTGTGACAACCAGGGGTGCT 0: 1
1: 0
2: 1
3: 5
4: 89
Right 975262786 4:72323551-72323573 TGGCTATGGGGTCTGTGTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975262786 Original CRISPR TGGCTATGGGGTCTGTGTGC AGG Intronic
900127755 1:1075935-1075957 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900127812 1:1076115-1076137 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900127907 1:1076413-1076435 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128181 1:1077221-1077243 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128190 1:1077251-1077273 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128206 1:1077311-1077333 AGTCTATGGGGACTCTGTGCCGG + Intergenic
900128330 1:1077701-1077723 AGGCTATGGGGACTCCGTGCGGG + Intergenic
900128434 1:1078001-1078023 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128463 1:1078091-1078113 AGGCTATGGGGACTCCGTGCGGG + Intergenic
900128665 1:1078661-1078683 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128726 1:1078841-1078863 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128747 1:1078901-1078923 AGGCTATGGGGACTCCGTGCGGG + Intergenic
900128756 1:1078931-1078953 AGGCTATGGGGACTCCGTGCGGG + Intergenic
900128776 1:1078991-1079013 AGGCTATGGGGACTCCGTGCGGG + Intergenic
900128817 1:1079111-1079133 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128826 1:1079141-1079163 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128890 1:1079321-1079343 AGGCTATGGGGACTCCGTGCCGG + Intergenic
900128921 1:1079411-1079433 AGGCTATGGGGACTCTGTGCAGG + Intergenic
901219521 1:7575396-7575418 TTGATATGGGGCCTGTGTTCTGG - Intronic
901532825 1:9864180-9864202 TGTCTCTGGGAGCTGTGTGCTGG - Intronic
901682263 1:10920131-10920153 TTGCTGTGGGGGGTGTGTGCTGG - Intergenic
903620679 1:24695895-24695917 AGGCTATGGGGACTGAGTCCTGG - Intergenic
904858754 1:33519562-33519584 TGGCCATGATGTCTGTGGGCTGG + Exonic
905306361 1:37021515-37021537 GGTCTATGGGGACTGTGGGCTGG - Intronic
905870236 1:41399379-41399401 TGGCTCTGGTGTCTCTGTGGGGG + Intergenic
907749790 1:57251912-57251934 TCTTTATGGGGTGTGTGTGCTGG - Intronic
908643425 1:66250299-66250321 TGGGTATGAGGTCTGTGAGCAGG - Intronic
909399586 1:75212208-75212230 TGGTTAAGGGGTATGTGTACAGG + Intronic
911578551 1:99607505-99607527 TGCATATGGGGTATGTGTGTTGG + Intergenic
912384465 1:109264344-109264366 TGGCTTTCGGGGCTGTTTGCAGG + Exonic
915821247 1:159026153-159026175 TGGCTATGTGGTCTGTTTTTTGG + Intronic
918794226 1:188872428-188872450 TGGGTATGGGGTATGTGAGAAGG - Intergenic
922526570 1:226308918-226308940 TTGTTATGGTGTCTGTGTGTTGG - Intronic
922618830 1:226978544-226978566 TGGCTGTGGGGGGTGTGTGGAGG - Intronic
922770915 1:228182573-228182595 TGGGGACGGGGTGTGTGTGCTGG + Intergenic
924659926 1:246006763-246006785 TAGCTGTGGGGTCTGCGTGGAGG - Intronic
1062926266 10:1317776-1317798 TGGCTCTGGTCTCTGTGGGCCGG + Intronic
1063379837 10:5577445-5577467 TGGGTGCGGGGTGTGTGTGCGGG - Intergenic
1066106591 10:32162341-32162363 TGGGAAAGGGGTCTGTGTGTCGG - Intergenic
1066145146 10:32549885-32549907 TGGCTATGGGGGCTCTGTTTTGG + Intronic
1067077625 10:43197231-43197253 TGGCCACGGGGTCAGCGTGCAGG - Intronic
1067310806 10:45111796-45111818 TGTGTATGGGGTGTGTGTGGGGG + Intergenic
1067435172 10:46272069-46272091 GGGCTGTGAGGTCTGGGTGCAGG - Intergenic
1067661093 10:48236645-48236667 TGGCTCTGGGGAATGTATGCTGG - Intronic
1067787748 10:49262918-49262940 TGGCTATGGTGTGTGTTTCCAGG - Intergenic
1068120876 10:52780905-52780927 TGGCTCTGGGGTCTGCTGGCTGG + Intergenic
1068266477 10:54656622-54656644 AGGTTATGGGGTATGTTTGCAGG - Intronic
1069591017 10:69641852-69641874 AGGCCCTGGGGTCTGTGTTCTGG + Intergenic
1070746957 10:78939531-78939553 TGGCTTTGGGGTGTGTCTCCAGG - Intergenic
1073285006 10:102382297-102382319 TGGGTATGGGATCTGTGGGGCGG - Exonic
1074371632 10:112905209-112905231 AGGCTGTTGGGGCTGTGTGCAGG + Intergenic
1074776390 10:116770994-116771016 GGGCTGTGGGCTGTGTGTGCTGG + Intergenic
1075568267 10:123520324-123520346 TGGCTTTGGGGCCTGTGTCAGGG - Intergenic
1077156799 11:1095711-1095733 CGGGGTTGGGGTCTGTGTGCTGG - Intergenic
1077156992 11:1096398-1096420 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157067 11:1096674-1096696 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157196 11:1097127-1097149 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157358 11:1097679-1097701 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157439 11:1097955-1097977 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157541 11:1098306-1098328 TGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157684 11:1098793-1098815 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077157825 11:1099276-1099298 TGGGGTTGGGGACTGTGTGCCGG - Intergenic
1077157865 11:1099414-1099436 CGGGGTTGGGGTCTGTGTGCCGG - Intergenic
1077302196 11:1852538-1852560 TGGCTTTGGGGGCTGTGCCCGGG - Intergenic
1077493753 11:2874908-2874930 TGGTACTGGGGTCTGTGGGCAGG - Intergenic
1077882840 11:6364395-6364417 GGGGTGTGGGGTCAGTGTGCAGG + Intergenic
1078833227 11:14996832-14996854 TGGCTATGCGGGCTGTTTTCTGG - Intronic
1079420165 11:20278583-20278605 TGCGGATGGGGTCTGTGTGTGGG + Intergenic
1082004958 11:47414384-47414406 TGGCTGCGGGGTCTGTGTTGAGG - Intronic
1083259701 11:61516374-61516396 TGGCTAAGAGCTCTGTGGGCGGG + Intronic
1083319698 11:61838216-61838238 TGGCTTTGGGGTGTGTGGTCCGG + Intronic
1083732615 11:64660960-64660982 AGGCTACGTGGGCTGTGTGCGGG - Exonic
1084116496 11:67045733-67045755 TGACGAAGGGGTCTGTGGGCAGG - Exonic
1084322697 11:68382441-68382463 GGGTTATGGGGTCTGTGTGGGGG - Intronic
1085524080 11:77154349-77154371 TGGCTGAGGGGTCTGAGAGCAGG + Intronic
1087805455 11:102550909-102550931 TGGCTATGGGGTCTGTAATCAGG - Intergenic
1088971027 11:114774874-114774896 TGTCTATGAGGACTGTGCGCTGG + Intergenic
1090655304 11:128838986-128839008 GGGCTCAGGGGTCTTTGTGCTGG + Exonic
1091193813 11:133715515-133715537 TGAGCATGGGGTCTGTGGGCAGG + Intergenic
1091679892 12:2519668-2519690 TGGCTAGTGGGGCTGTGTACTGG + Intronic
1094692229 12:32781126-32781148 TGGACAAGGGGTCTGGGTGCTGG - Intergenic
1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG + Intergenic
1097726053 12:63077046-63077068 TGACTATGGGGACTGTGCCCTGG + Intergenic
1100551380 12:95649489-95649511 TTACAATGGGGTGTGTGTGCAGG + Intergenic
1101086690 12:101243464-101243486 TGGCACTAGGATCTGTGTGCTGG + Intergenic
1101449643 12:104764397-104764419 TGGCTATGGCCTCTGGGTTCTGG + Intergenic
1103177372 12:118876421-118876443 TGACTGTGGGGGCTGTGTTCGGG + Intergenic
1106036220 13:26047734-26047756 AGGTGATGGGGTCTGTGTGGAGG + Intronic
1111949986 13:94702624-94702646 AGGCTAGGGTGTGTGTGTGCGGG + Intergenic
1112338330 13:98532513-98532535 TGGGTATGGGATGTGTGTGTGGG - Intronic
1113614441 13:111670816-111670838 TGCCCCTGGGGTCTGTGTGGAGG + Intronic
1113619909 13:111755730-111755752 TGCCCCTGGGGTCTGTGTGGAGG + Intergenic
1117773737 14:59161056-59161078 TGGCTATTTAGTCAGTGTGCAGG + Intergenic
1118775211 14:68969630-68969652 TGTCTGTCGGGTCTGTGAGCAGG - Intronic
1118831046 14:69433005-69433027 TGGCTATTTGGTCTGTTTTCTGG + Intronic
1119118606 14:72051585-72051607 TGGGGATGGGGTGTGTGTGGCGG + Intronic
1120783485 14:88508433-88508455 TGTCTAGGGGCTCTGTGTGGTGG - Intronic
1121335415 14:93074955-93074977 TGGCTTAGGGGTGTGTGTTCAGG - Intronic
1122159264 14:99771198-99771220 TGGGTATGGGGTCTTTTTTCAGG - Intronic
1122445310 14:101763182-101763204 TGCCTATGGGGTTTGTTTGTGGG + Intronic
1122979811 14:105186410-105186432 TGTGTATGGGGTGTGTGTGTGGG + Intergenic
1122979851 14:105186546-105186568 TGTGTATGGGGTGTGTGTGTGGG + Intergenic
1122979891 14:105186682-105186704 TGTGTATGGGGTGTGTGTGTGGG + Intergenic
1124531019 15:30506515-30506537 TGTATATGGGGACTGTGTGTGGG + Intergenic
1124767636 15:32501180-32501202 TGTATATGGGGACTGTGTGTGGG - Intergenic
1125589532 15:40845668-40845690 TGGCTCTGGGCTGTGTGTACTGG + Intronic
1128258067 15:66212752-66212774 TGGCAGTGGGGACTCTGTGCTGG - Intronic
1128353546 15:66908327-66908349 TGGCTTTGGGGGCTGGGTGCAGG - Intergenic
1128571984 15:68740488-68740510 AGGCTTTGGGTGCTGTGTGCTGG - Intergenic
1130843410 15:87722955-87722977 TGGCCATGGTGGCTCTGTGCAGG + Intergenic
1134509424 16:14834270-14834292 AGGATCTGGGGTCTGTGTTCCGG - Intronic
1134697129 16:16233085-16233107 AGGATCTGGGGTCTGTGTTCCGG - Intronic
1135972714 16:27084189-27084211 TGGCTGCGGGGTCTATGTCCAGG + Intergenic
1136599928 16:31278214-31278236 AGGCTTTGGGGGCTGTGAGCTGG + Intronic
1137223823 16:46482514-46482536 GGGATATGGGGTATGTCTGCAGG - Intergenic
1138125876 16:54437958-54437980 TGGCTATGAGGGATGTCTGCTGG + Intergenic
1138973158 16:62170768-62170790 GGGCTGTGGGGTGTGTTTGCAGG + Intergenic
1140472750 16:75224418-75224440 TGGCCAAGGGGTCCGTGTGAGGG - Intronic
1141554921 16:84830818-84830840 TGTCTATGGGATCTGCGTGATGG + Intronic
1142119821 16:88381770-88381792 TGGCAGTGGGGTTTCTGTGCTGG - Intergenic
1144755053 17:17674938-17674960 AGACTATGGGGGCTGTGTGGTGG + Intergenic
1144773792 17:17773844-17773866 TGGCTATGGGGTCTGGGATAAGG - Intronic
1146676555 17:34777276-34777298 TGGCACTGTGGGCTGTGTGCTGG - Intergenic
1150149278 17:62795915-62795937 TGGCTATGGTGACTTTGTGGTGG - Intronic
1151326182 17:73380948-73380970 TGGCTATGGGGTGGGGGTGCCGG + Exonic
1151966443 17:77434083-77434105 TGGGTTTGGTGTCTGTGGGCTGG + Intronic
1152394641 17:80025153-80025175 TGTCTATGGTGTGTGTGTCCTGG - Intronic
1152616059 17:81338438-81338460 TTGCTCTGAGGTCTGTGTGTGGG + Intergenic
1153274852 18:3358378-3358400 TGACTTACGGGTCTGTGTGCTGG - Intergenic
1155074972 18:22346735-22346757 TGGCCCTGGAGTCTGTGTCCTGG + Intergenic
1158539805 18:58342952-58342974 TGGCTGTGGGGACTGTGGGTTGG - Exonic
1161012831 19:1968491-1968513 TGGCTGAGGGGACTCTGTGCAGG - Intronic
1161039793 19:2104121-2104143 TGGCGTTGGGGTCTGAGTGTTGG - Intronic
1161039817 19:2104275-2104297 TGGCGTTGGGGTCTGGGTGTTGG - Intronic
1161039835 19:2104359-2104381 TGGCGTTGGGGTCTGGGTGTTGG - Intronic
1161039855 19:2104443-2104465 TGGCGTTGGGGTCTGGGTGTTGG - Intronic
1161039876 19:2104527-2104549 TGGCGTTGGGGTCTGGGTGTTGG - Intronic
1166376205 19:42328589-42328611 TGGCGAAGGGGTCTGTGTGCTGG + Intronic
1167760416 19:51443797-51443819 TGGCTCTGAGGGCTGTGTACGGG - Intergenic
925051665 2:820323-820345 TGGCACTGGGGGCTGAGTGCAGG - Intergenic
925140707 2:1548130-1548152 TGTCTGTGTGGTGTGTGTGCAGG - Intergenic
925257858 2:2505572-2505594 TGGTAATGCTGTCTGTGTGCAGG - Intergenic
925990327 2:9249593-9249615 TGGCTATGCAGTCTATGTGATGG - Intronic
934768713 2:96894747-96894769 TGGGTAGGGGGTCTGTGGGGGGG - Intronic
934935676 2:98463652-98463674 TGGCCCTGGGGTCTGTCTGTAGG + Intronic
937928053 2:127182984-127183006 TGGCTCTGCTGTCTCTGTGCTGG + Intergenic
938261177 2:129896041-129896063 TGGCTGTGGGGTGGGGGTGCAGG - Intergenic
938616801 2:133007638-133007660 TGGGTAGGGGGTCTATGTCCTGG + Intronic
939095221 2:137826577-137826599 TGGCTCTGGGGACTGACTGCTGG + Intergenic
940630230 2:156229463-156229485 TGCCTATGGGCTCTTTCTGCTGG - Intergenic
940936574 2:159502185-159502207 TGGATATTGGGTCTGTTTGGGGG + Intronic
941933894 2:170968457-170968479 TGGGGCTGGGGCCTGTGTGCTGG + Intergenic
942047578 2:172108724-172108746 TGCCTATGGGGCCTGTGCGCTGG - Intergenic
945341975 2:208667206-208667228 TGAATATGTGGACTGTGTGCTGG + Intronic
946488365 2:220123006-220123028 TTGCTTTTGGGTCTCTGTGCTGG - Intergenic
947705194 2:232269192-232269214 TGGCAATGGGGGCAGTGTGGGGG - Intronic
948599837 2:239101809-239101831 TGGGTCTGGGTTCTGTGTCCTGG + Intronic
948784786 2:240346732-240346754 TGTGTGTGGGGTCTGTGTGTGGG - Intergenic
949040964 2:241849842-241849864 TGGCTGTGGGGGCAGTGGGCAGG - Intergenic
1170878891 20:20277389-20277411 TGTAGATGGGGTCTGGGTGCAGG - Exonic
1172596391 20:36154005-36154027 TGGGGATGGGGCCTGTGTACAGG - Intronic
1173292906 20:41729958-41729980 TGGCTTTGGGGTCTGAGGTCTGG - Intergenic
1174401466 20:50278192-50278214 TGGGTCGGGGGTCTGTTTGCAGG - Intergenic
1174559389 20:51419213-51419235 TGGATTTGGGGTCTTTGTGCAGG - Intronic
1175271484 20:57737096-57737118 AGGCTATGGGCTCTGAGTCCTGG + Intergenic
1175579660 20:60088543-60088565 TGGCCTTGGCGTCTGTGTCCTGG + Intergenic
1176064957 20:63189456-63189478 TGCCTGTGTGGTTTGTGTGCTGG - Intergenic
1176210766 20:63920207-63920229 GGGCTCTGGGGTCTGAGTGAGGG + Intronic
1178838873 21:36122372-36122394 TGGCTATGGGGTTTGTTTTAGGG + Intergenic
1179248550 21:39654067-39654089 TTGCTGCTGGGTCTGTGTGCAGG + Intronic
1179931405 21:44573354-44573376 TGGCTCTGCCGTGTGTGTGCTGG - Intronic
1181106783 22:20580309-20580331 TGGCAATGAGGGCTGTGTGGTGG + Intronic
1181804476 22:25366635-25366657 TGGCCCTGGGCTCTGTGTCCTGG - Intronic
1182712182 22:32330008-32330030 GGGCTCTGGTGTCTGTGTGTTGG + Intergenic
1183368565 22:37419830-37419852 TGGCGAGGGGGTGTGTGTGCCGG - Intronic
1184365234 22:44046945-44046967 TGGCTCCTGGGTCGGTGTGCGGG + Intronic
1184723531 22:46329800-46329822 TGGCCCTGGGGTCTATGGGCAGG - Intronic
1185205229 22:49534050-49534072 AGGCCATGGGGTCTGGGTGTAGG - Intronic
953031982 3:39185436-39185458 TGGCTCTGGGTTAGGTGTGCAGG + Exonic
955847651 3:63183740-63183762 TGGCTATGTGGGCTCTGTGTTGG - Intergenic
956724572 3:72146386-72146408 TGGAAATGGGGTTTGGGTGCAGG + Intergenic
958158315 3:89784702-89784724 TGGCTCTGGGCTCTGTGGACAGG - Intergenic
960584227 3:119305853-119305875 TAGCTATAGGCTCTGTGTCCAGG - Intronic
963040348 3:141065591-141065613 TGGCTTCAGGGTCTGTGTTCCGG - Intronic
963059890 3:141217109-141217131 AGGCTTTCGGGTCTGTGTGGGGG - Intergenic
966925753 3:184643569-184643591 TGTCTTTGGGGTGTGTGTGTTGG + Intronic
967946402 3:194807597-194807619 TGGCTCTGGCGTCACTGTGCTGG - Intergenic
968699103 4:2046490-2046512 AGGCTCTGGGCTCTGTGGGCTGG - Intergenic
970371659 4:15413178-15413200 TGGCTATGGAGGTTGTGTGCAGG - Intronic
971971873 4:33631357-33631379 TGGGAGTGGGGTCTGAGTGCTGG + Intergenic
975093720 4:70433201-70433223 TGGCTATGGGGTCTCTTTTTTGG + Intronic
975262786 4:72323551-72323573 TGGCTATGGGGTCTGTGTGCAGG + Intronic
975318779 4:72985423-72985445 TAGCTATGGGTTATATGTGCAGG - Intergenic
981053557 4:140336340-140336362 TGGCTATGGGGTGTGTTTCTGGG - Intronic
986239964 5:5951998-5952020 TGGCCCTGGGGTGGGTGTGCTGG + Intergenic
989780800 5:45262524-45262546 TGGCTGGGGGGTCTGTGTGCTGG + Exonic
991562349 5:67966990-67967012 TGCCCAAGGGGTCTGTGTTCTGG - Intergenic
992268789 5:75044683-75044705 TGGAGATGGTGTCTGGGTGCGGG - Intergenic
993087140 5:83377157-83377179 TGGCAATGGGCTCTCTTTGCAGG + Intergenic
997103557 5:130994432-130994454 GGGATATGGGGGCTGTGGGCTGG - Intergenic
997964253 5:138345238-138345260 GGGCTGTAGGGTCTGTGAGCTGG - Exonic
998008233 5:138671844-138671866 CAGCTATGGGGTCTCTGGGCAGG + Intronic
999053599 5:148550151-148550173 TGGTGATGGTGGCTGTGTGCTGG - Exonic
999233375 5:150076092-150076114 TGGCTATGGTGATTGGGTGCAGG - Intronic
1001253847 5:170168890-170168912 TGGCCCTGGGGTCTGTTTCCAGG + Intergenic
1001714394 5:173802989-173803011 TGGCGCAGGGGTCTGTGGGCAGG + Intergenic
1002023232 5:176379090-176379112 TAGCTATGGGGTCTAATTGCAGG + Exonic
1002024515 5:176388024-176388046 GGGGTATGGGGAATGTGTGCTGG + Intronic
1002430218 5:179199065-179199087 AGGCTATGGGGTCTGAGCGCAGG + Intronic
1003157111 6:3606420-3606442 TGGTGATGGGGTGTGTGTGGCGG - Intergenic
1007070702 6:39036148-39036170 GGGATATGGAGTCTGTATGCAGG - Intergenic
1007824980 6:44593680-44593702 TGGCTCAGGGGTCTGTGTACTGG + Intergenic
1009033728 6:58091789-58091811 TGGCTCTGGAGTATGTGAGCTGG - Intergenic
1009209338 6:60843496-60843518 TGGCTCTGGAGTATGTGAGCTGG - Intergenic
1010430725 6:75775485-75775507 TGGCTCTGAGGCCTGTGTACGGG + Intronic
1014107720 6:117585739-117585761 TGGGTATGGGGTGTGTGTATGGG - Intronic
1017208381 6:151828114-151828136 TGCCTATGGGAACTTTGTGCAGG + Intronic
1017792644 6:157814976-157814998 TGGCCCTGGGGTTGGTGTGCTGG + Intronic
1018960415 6:168443402-168443424 TGCATGTGGGGTCTCTGTGCAGG + Intronic
1019256777 7:57397-57419 TGCCTATGGGGGCTGTGTGGAGG - Intergenic
1019416880 7:931948-931970 TGGCCAAGGGGCCTGAGTGCAGG + Intronic
1020256337 7:6504637-6504659 TGGCTATGGGGCCTGGGAGGGGG + Intronic
1022342255 7:29479690-29479712 TGGCTGGGGGGTGTGTGCGCTGG + Intronic
1029746006 7:102516247-102516269 TGGCAGTGAGGTCTGTGGGCTGG - Intronic
1029763944 7:102615226-102615248 TGGCAGTGAGGTCTGTGGGCTGG - Intronic
1030379425 7:108795360-108795382 TAGCTATAAGGTCTGTGTCCTGG + Intergenic
1031586145 7:123534394-123534416 GGACTCTGGGTTCTGTGTGCTGG - Intronic
1031876697 7:127149867-127149889 TGGTTATGGGGTCAGGGTGGGGG + Intronic
1034350812 7:150413663-150413685 TTGCTATGGGGACTGGGTGGAGG + Intergenic
1039556927 8:38483215-38483237 TGGCTAAGGGGGCTTTGTCCTGG + Intergenic
1039944385 8:42117248-42117270 TGGCTATGGGGACTGTTGGCGGG - Intergenic
1043643620 8:82488936-82488958 TGCATGTGGGGTCTGTGGGCAGG + Intergenic
1045431013 8:102115008-102115030 TGAGTATGGGGCCTGTGTGATGG - Intronic
1046453270 8:114421894-114421916 AGGATCTGGGGTATGTGTGCAGG - Intergenic
1046577529 8:116049488-116049510 TGACCATGGGGTCTTTTTGCTGG - Intergenic
1047882583 8:129212684-129212706 TGGCTTTGGGATGTGTGTGTTGG + Intergenic
1048900484 8:139032622-139032644 TGGCTGAGGGGTCTGTTTTCAGG - Intergenic
1049250440 8:141585739-141585761 TGGCCCTGGGGTCTGTGTCCTGG - Intergenic
1049750388 8:144280389-144280411 TGGTTCTGGGGTCTGGGTGCTGG - Intronic
1049812720 8:144582665-144582687 TGGCTCAGGGGTCTGGCTGCAGG + Intronic
1051609086 9:18943873-18943895 CTGCTATGGACTCTGTGTGCAGG - Intronic
1051613196 9:18981500-18981522 GGGCTCTGGGCTCTGTGTGAGGG - Intronic
1052795227 9:32917589-32917611 TGGGTATGTGGTTTGTGTGTTGG - Intergenic
1056803892 9:89713157-89713179 TGGCTGAGGGGTCAGTGTGCAGG + Intergenic
1057890573 9:98867000-98867022 TGGATTTGGGGTCTGAGGGCTGG - Intergenic
1059147425 9:111913000-111913022 TGGCTAAGTGGTCTGGGTGGTGG + Intronic
1059325819 9:113503544-113503566 TGGATGTGGGGTCTGGGTGTGGG + Intronic
1060496827 9:124125503-124125525 GGGCAGTGGGGTCTGTGGGCAGG - Intergenic
1061090695 9:128424343-128424365 AGGCCTTGGGGTCTGTGGGCAGG + Intronic
1061204118 9:129153148-129153170 TGGGTATGGGGCCTGTGAGAGGG + Intergenic
1061631039 9:131872323-131872345 TGGCCTCGGGGGCTGTGTGCTGG - Intronic
1062123563 9:134847556-134847578 TGCCTGTGTGGTGTGTGTGCTGG + Intergenic
1062236199 9:135509040-135509062 TTGCCAGTGGGTCTGTGTGCGGG - Intergenic
1185479951 X:438636-438658 CGGCTATGTGGCCTGTTTGCTGG + Intergenic
1185480064 X:439251-439273 CAGCTCTGGGGTCTGTGTGAAGG - Intergenic
1186593523 X:10956030-10956052 TAGCTTTGGGGTTTGTTTGCTGG - Intergenic
1187601653 X:20838681-20838703 GGGCTGTGGGGTATGTCTGCAGG + Intergenic
1189570799 X:42294361-42294383 AGGCTCAGGGGTATGTGTGCAGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191679040 X:63822919-63822941 TGGCTATGCGGGCTGTGTTTTGG + Intergenic
1192775475 X:74240232-74240254 GGGCTGTGGTGTCTGTGTGATGG - Intergenic
1192932619 X:75824211-75824233 TGGCTATGTGGCCTGTGGGATGG - Intergenic
1195668573 X:107451005-107451027 GGGCTGTGGTGTGTGTGTGCAGG - Intergenic
1198154420 X:133944956-133944978 TGGCTATGTGGTCTGGCTTCAGG - Intronic
1200992253 Y:9356418-9356440 GGGGTATGGGGGCTGTTTGCGGG - Intergenic
1201002740 Y:9485888-9485910 GGGGTATGGGGGCTGTTTGCGGG - Intronic
1201941615 Y:19466443-19466465 TGGCTATGAGGTGAGTGTCCTGG - Intergenic