ID: 975265022

View in Genome Browser
Species Human (GRCh38)
Location 4:72353438-72353460
Sequence CACAGCTAGCAACTAGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975265022_975265025 29 Left 975265022 4:72353438-72353460 CCTATGTCTAGTTGCTAGCTGTG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 975265025 4:72353490-72353512 TTGTAGCTGTTTGTTACCCTTGG No data
975265022_975265024 -5 Left 975265022 4:72353438-72353460 CCTATGTCTAGTTGCTAGCTGTG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 975265024 4:72353456-72353478 CTGTGTGGATGCTGAAAGAAAGG 0: 1
1: 0
2: 5
3: 33
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975265022 Original CRISPR CACAGCTAGCAACTAGACAT AGG (reversed) Intronic
902965733 1:20000311-20000333 CACAGAAAGCAACCATACATAGG + Intergenic
904252300 1:29233844-29233866 CACAGCTAGTAAATAGACGGCGG - Intergenic
905278384 1:36833640-36833662 CCCAACTAGGAACTAGACCTTGG - Intronic
909254996 1:73408571-73408593 CACACCTAGCACCCAGAGATTGG + Intergenic
911234766 1:95400491-95400513 CACAGTTAGCAGCTAAATATTGG + Intergenic
913252560 1:116924115-116924137 CACAGGTAGAGACGAGACATAGG - Intronic
916875840 1:168967689-168967711 CCCAGCTAGCATCTAGACCTTGG - Intergenic
917550545 1:176023014-176023036 CAAAGCTAGAAACTAGACACTGG - Intronic
919214736 1:194537441-194537463 CACATCTAGCACCAAGACTTTGG - Intergenic
921556302 1:216602017-216602039 CACAGCTAGGAAATAAGCATTGG + Intronic
923553431 1:234981797-234981819 CACAGACATCAACAAGACATGGG + Intergenic
1063063222 10:2579415-2579437 AAAAGCTGGTAACTAGACATAGG + Intergenic
1063649435 10:7918507-7918529 CACAGCTAGGAACAAGAGCTGGG + Intronic
1065898661 10:30186191-30186213 AACAGCTAACACCTAGACAGAGG + Intergenic
1070594847 10:77825420-77825442 CAAAGCTAGCATATTGACATTGG - Intronic
1071114933 10:82206964-82206986 CACAGCAGTCAACTAGACAAGGG - Intronic
1075842958 10:125519547-125519569 CACACCCAGCACCTAGATATTGG + Intergenic
1076286464 10:129302468-129302490 CACACCTAGCAACCAGATCTTGG + Intergenic
1078056918 11:8016652-8016674 CACAGCCAGGCACCAGACATAGG - Intergenic
1080879259 11:36303866-36303888 CACTGCTAGCAACCCAACATTGG + Intronic
1087180857 11:95141100-95141122 CACAGCCAGTAACTGGACTTGGG + Intergenic
1087668802 11:101081866-101081888 AACAGCTAACAACTAAACAAGGG + Intronic
1091008777 11:131979057-131979079 CAAAGTTAGGAACCAGACATAGG + Intronic
1101756728 12:107626838-107626860 GACAACTACCAAATAGACATAGG + Intronic
1104537349 12:129630543-129630565 GAGAGCTAGCAAATAGAGATAGG + Intronic
1104689291 12:130813384-130813406 CACTGCTAACACCTAGACCTGGG + Intronic
1104933223 12:132351442-132351464 CACAGGCAGCAGCTAGACACAGG + Intergenic
1113166562 13:107449896-107449918 CACAGCTAGTAAGTAGGCAGAGG + Intronic
1125826975 15:42684884-42684906 CACAGATAGCAACTACTCATTGG + Exonic
1129122563 15:73409923-73409945 CAAAGCAAGACACTAGACATTGG - Intergenic
1129464288 15:75715254-75715276 CCCAGCTAGCAACAAGGCAGGGG - Intergenic
1129526041 15:76215101-76215123 CACAGATAAAAACAAGACATAGG + Intronic
1129720961 15:77877758-77877780 CCCAGCTAGCAACAAGGCAGGGG + Intergenic
1141748203 16:85940272-85940294 CACAGGTAGCTACAAGACACAGG - Intergenic
1144081794 17:11769839-11769861 CAGAGCTCCCAAATAGACATGGG + Intronic
1144277458 17:13687441-13687463 CACATCTAGCATCTAGATTTTGG - Intergenic
1149650467 17:58273178-58273200 CACAGCGAGCCACAACACATAGG + Intronic
1153527556 18:6012142-6012164 CACAGCTAACATCTAGAAACTGG + Intronic
1155012429 18:21793126-21793148 AACAGCTAGCAAATATTCATTGG + Intronic
1165865896 19:38938237-38938259 CACAGAAAGCAACCATACATAGG - Intronic
925504540 2:4546590-4546612 CACAGCTAGCAACAATATTTTGG + Intergenic
926239209 2:11072035-11072057 CACACCTAGCACCCAGACTTTGG + Intergenic
929293348 2:40218248-40218270 CACAGCTAGCAACAGGAAATGGG - Intronic
931591843 2:63892850-63892872 CAAAGCCTGCAACTTGACATTGG + Intronic
933010096 2:77050695-77050717 CACAGCTAGCAAAAAGAAATAGG - Intronic
933586219 2:84182140-84182162 CACAGCCAACAACTTGACTTTGG + Intergenic
936512890 2:113162653-113162675 CACAGCAAACAAATAGAGATGGG - Intronic
938552084 2:132391743-132391765 CACAACCAGCAACTAAACAAAGG + Intergenic
938845821 2:135207731-135207753 CACAGCTTGCAAATAGCCTTTGG + Exonic
940498880 2:154469517-154469539 CAGAGGAAGCAACTACACATCGG - Intergenic
940639131 2:156329609-156329631 CGCATCTGGCAACTAGACACCGG + Exonic
940767677 2:157807696-157807718 CACAGCTAGAAATGAGACAGAGG - Intronic
940997189 2:160162506-160162528 CACAGCATGCAACTAGATCTGGG + Intronic
943276717 2:185876609-185876631 CACAGCCAGCACCTAGACACAGG + Intergenic
943431696 2:187810653-187810675 CACACCTGGCACCTAGATATTGG + Intergenic
947551055 2:231047144-231047166 CACAGTTACCAGCTAGACAGTGG + Exonic
1169820403 20:9703652-9703674 CAGAGCCAGAAACAAGACATTGG - Intronic
1170894801 20:20403444-20403466 CAAAGCTAGCAACTTGCCAGAGG - Intronic
1174728187 20:52887482-52887504 CACACCTAGCACCTAGATCTTGG + Intergenic
1182784515 22:32896029-32896051 TATAGCTAAGAACTAGACATAGG + Intronic
954388485 3:50256818-50256840 CTCAGCTAGCACCAAGTCATAGG - Exonic
956784232 3:72628996-72629018 AACACCTAGCAACTGGAAATTGG + Intergenic
956819611 3:72941917-72941939 CACACCTAGCACCTAGATATTGG + Intronic
961140160 3:124549109-124549131 CACAGCTAACAGCTAGTCAGTGG + Intronic
967278536 3:187800246-187800268 CACAGCTAGCTGCTGGACAGAGG - Intergenic
970230194 4:13901872-13901894 CACAGCTAACAACAAGTGATGGG - Intergenic
972095912 4:35346787-35346809 CACTGCTAGCATTGAGACATTGG - Intergenic
973635482 4:52858423-52858445 CAAAGCTAGAGACCAGACATTGG - Intergenic
975265022 4:72353438-72353460 CACAGCTAGCAACTAGACATAGG - Intronic
976258913 4:83127225-83127247 CCCAGCTAGCAACTAAATCTTGG - Intronic
978972331 4:114823936-114823958 CACAGCTAGCAGCTAGTAAGAGG + Intergenic
979325823 4:119378409-119378431 AAAAGCAAGCAACTATACATTGG + Intergenic
980804546 4:137794773-137794795 CACAGCTTCCAATTAGACATAGG - Intergenic
981078219 4:140612150-140612172 CACAGCAAACACCTGGACATGGG + Intergenic
982495553 4:156087387-156087409 CAGAGAAAGCAACTAGGCATAGG - Intergenic
983243739 4:165263539-165263561 AAAAGCAAGCAACTATACATTGG + Intronic
985275274 4:188232376-188232398 CACAGTTAGGATATAGACATGGG - Intergenic
986898366 5:12399664-12399686 CAAATCTAGAAAATAGACATTGG - Intergenic
987159397 5:15125584-15125606 CACATCTAGGAAATTGACATTGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
992124913 5:73630038-73630060 CAAAGCTTGCCACTAGAAATAGG - Intronic
992176006 5:74149262-74149284 CACAGCTACCTACTTTACATAGG + Intergenic
993406153 5:87513914-87513936 CACAGAAAGTAACTATACATAGG + Intergenic
993814379 5:92523141-92523163 CACAACTAGCATCCAGACCTCGG + Intergenic
994661552 5:102660423-102660445 CAGAGCTAGAAACTAGTCAATGG + Intergenic
1003455930 6:6282143-6282165 CACACCTAGGATCTAGACCTTGG + Intronic
1005076784 6:21916336-21916358 CAGAGCTAGCACTTAGACAACGG - Intergenic
1006946475 6:37787836-37787858 CCCAGCCAGCTACTAAACATGGG + Intergenic
1007116652 6:39347900-39347922 CACTGCTAGGAAATGGACATTGG - Intronic
1008007278 6:46424329-46424351 CACAGCAAGCAAGTAGAACTGGG + Intronic
1011651086 6:89506786-89506808 CACACCTTGCAGCTAGAGATCGG - Intronic
1018095758 6:160385839-160385861 CACAGATAGAAACTAGAGAATGG - Intronic
1018098777 6:160417734-160417756 CACATCTAGCAACCTGCCATTGG - Intronic
1020756308 7:12208016-12208038 CACAGCTAGCAACTAGAACTCGG - Intergenic
1021580964 7:22153014-22153036 CACAGCCACCAAATAGATATTGG + Intronic
1024532593 7:50406084-50406106 CACAGGTAGCAATTAAACTTAGG + Intergenic
1029041164 7:97576322-97576344 CACAGCCATCAACAAGACATTGG - Intergenic
1033322071 7:140349003-140349025 CACAGCTAAGAAGTAGCCATAGG - Intronic
1033710136 7:143934415-143934437 CACAGCTAGCAAGAACACAGAGG + Intergenic
1035003806 7:155640253-155640275 CACACCCAGCACCTAGACCTTGG - Intronic
1037856809 8:22377418-22377440 CATACCTAGCAACCAGACCTTGG - Intronic
1039173153 8:34772109-34772131 CACAGTTGGCAATTAGACACTGG - Intergenic
1039977113 8:42376522-42376544 CACAGCCAGCAAGCAAACATGGG - Intronic
1040577001 8:48661306-48661328 CACACCTAGCAACCAGACCTTGG - Intergenic
1045041551 8:98229079-98229101 AGCATCTAGCATCTAGACATTGG - Intronic
1045637308 8:104207264-104207286 CAGAGCTAGCAAATAGAGACTGG + Intronic
1046185982 8:110718984-110719006 TTCAGCTATCAACTAGAGATTGG + Intergenic
1047722908 8:127658503-127658525 CACACCTAGACAATAGACATTGG - Intergenic
1048030115 8:130623221-130623243 CACATCTAGCACCTAGATCTTGG - Intergenic
1052824741 9:33166821-33166843 CCCCGCTAGCAACTTGACCTCGG - Exonic
1055683688 9:78745521-78745543 CACAGCTAGAGACTAAAGATAGG - Intergenic
1060589790 9:124809542-124809564 CACAGCTAGGATTTAGACACAGG - Intronic
1061285947 9:129622514-129622536 CACACCTAGCACCCAGACCTTGG - Intronic
1061320628 9:129826205-129826227 CACACCTAGCACCCAGACCTTGG - Intergenic
1185847062 X:3447579-3447601 CAAAGGAAGCAACTGGACATCGG + Intergenic
1186348765 X:8721848-8721870 CCCAGCTAGCAGCCAGACTTTGG - Intronic
1190155400 X:47987784-47987806 CACAGCTAGCACCCAGATTTTGG + Intronic
1193905254 X:87235987-87236009 CACAACCAGGAAATAGACATTGG + Intergenic
1198497899 X:137212239-137212261 CACAGCTGGCAACTTGACACTGG + Intergenic