ID: 975267164

View in Genome Browser
Species Human (GRCh38)
Location 4:72383556-72383578
Sequence AGGGGTCAGCCAGAGGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975267164_975267171 21 Left 975267164 4:72383556-72383578 CCAACAACCTCTGGCTGACCCCT 0: 1
1: 1
2: 3
3: 21
4: 210
Right 975267171 4:72383600-72383622 GACTCTAAGCAGCCCAGCTAAGG 0: 1
1: 6
2: 15
3: 28
4: 120
975267164_975267170 -1 Left 975267164 4:72383556-72383578 CCAACAACCTCTGGCTGACCCCT 0: 1
1: 1
2: 3
3: 21
4: 210
Right 975267170 4:72383578-72383600 TGAACTATATGTGTTCGAGGCGG 0: 1
1: 0
2: 2
3: 2
4: 57
975267164_975267172 29 Left 975267164 4:72383556-72383578 CCAACAACCTCTGGCTGACCCCT 0: 1
1: 1
2: 3
3: 21
4: 210
Right 975267172 4:72383608-72383630 GCAGCCCAGCTAAGGCTAAAAGG 0: 1
1: 1
2: 12
3: 72
4: 282
975267164_975267168 -4 Left 975267164 4:72383556-72383578 CCAACAACCTCTGGCTGACCCCT 0: 1
1: 1
2: 3
3: 21
4: 210
Right 975267168 4:72383575-72383597 CCCTGAACTATATGTGTTCGAGG 0: 1
1: 0
2: 0
3: 7
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975267164 Original CRISPR AGGGGTCAGCCAGAGGTTGT TGG (reversed) Intronic
900948251 1:5843378-5843400 AGGGGTCAGGGAGAGGTCCTGGG + Intergenic
901766389 1:11502517-11502539 CAGGGTCAGAGAGAGGTTGTGGG + Intronic
901914014 1:12484024-12484046 AGGCTTCAGCCAGATGTTTTTGG + Intronic
902034858 1:13450225-13450247 AGGGGTCACCCCGAGGGTCTAGG + Intergenic
902642145 1:17773955-17773977 AGAGGGTAGCCAGAGGTGGTGGG + Intronic
905972710 1:42153701-42153723 TGGGGGCAGCCAGATGTTGATGG + Intronic
907031953 1:51181018-51181040 AGGAGGCAGGCAGAGGTTGCAGG + Intergenic
907232280 1:53010908-53010930 AGGAGTCAGCAAAAGGTGGTGGG - Intronic
907307550 1:53521747-53521769 TGGGGACAGCCAAGGGTTGTTGG - Intronic
907524889 1:55048358-55048380 AGGTCACAGCCACAGGTTGTGGG + Intronic
907742981 1:57185065-57185087 AGGGGTGAGCAAGAGGTTGGTGG - Intronic
910453414 1:87370855-87370877 GGGGGACAGCCAGATGTTGGTGG + Intergenic
910519619 1:88105065-88105087 AGAGGGCACTCAGAGGTTGTGGG + Intergenic
910809867 1:91225217-91225239 TGGGGTCAAACAGAGGTTTTGGG + Intergenic
912437330 1:109671007-109671029 GGGGCTGACCCAGAGGTTGTTGG + Intronic
912522559 1:110255800-110255822 AGGGGTCAGCCAGAAGATGGAGG + Intronic
912749208 1:112271675-112271697 AGGTCACAGCCAGAGGTTCTGGG + Intergenic
914957967 1:152181724-152181746 AGGGGACATCCAGAGCTTGGAGG - Intergenic
915571014 1:156745049-156745071 AGGGTTCAGCGAGGGGCTGTGGG - Exonic
915728851 1:158038332-158038354 GGGGGTCAGTCAGTGGTGGTGGG + Intronic
915897864 1:159825384-159825406 AGGAGAGAGCCAGAGGTTGGGGG - Intergenic
916044090 1:160985770-160985792 AGGGGTCAGCAAAAGGTGGTGGG + Intergenic
917303521 1:173603875-173603897 AGGGCTGAGCCAGATGGTGTTGG - Intergenic
919948695 1:202342123-202342145 AGGGTTCAGCCGCAGGGTGTAGG - Intergenic
920969368 1:210729994-210730016 AGGGCCCAGCCAGAAGTTGGGGG - Intronic
921572685 1:216797658-216797680 TGGGATCAGACAGGGGTTGTGGG + Intronic
923256319 1:232224459-232224481 CAGGGTCATCCAGAGGTGGTGGG - Intergenic
923519681 1:234725924-234725946 AGGTGTCAGCCAGGGTGTGTGGG - Intergenic
1065214502 10:23437713-23437735 AAGGGAAAGCCAGAGGTAGTGGG - Intergenic
1065572737 10:27088625-27088647 AGGGGTCAACCACAAGTTGGTGG + Intronic
1067037798 10:42932660-42932682 AGGGATGAGCCTGAGGTTTTAGG - Intergenic
1068041120 10:51825600-51825622 AGGTGTCAGGCAGCTGTTGTAGG - Intronic
1068046073 10:51887855-51887877 AGGTGGTAGCCAGAGGTTGTGGG + Intronic
1070955979 10:80464019-80464041 AGGAGTCAGCCAGAGCGAGTTGG + Intronic
1073175505 10:101554051-101554073 AGGGGGCAGGCAGAGGGGGTGGG + Exonic
1073184702 10:101608874-101608896 AGGCGTCATCCAGAGGTAGCTGG - Exonic
1074976636 10:118586904-118586926 AGGGGTCAGCCTGGGGTGGAAGG - Intergenic
1075009776 10:118857723-118857745 AGGGACCAGCCTGAGGTTGTAGG - Intergenic
1076485024 10:130810342-130810364 AGGGAGCAGCCAGGGGTAGTGGG - Intergenic
1078763558 11:14272117-14272139 GGTGGTCAGATAGAGGTTGTTGG - Intergenic
1079392722 11:20036273-20036295 AGGGGTCAGGCAGCGGATGGTGG + Intronic
1079710395 11:23676311-23676333 TGGGGCCTACCAGAGGTTGTAGG + Intergenic
1080581962 11:33651604-33651626 AGGGGACAGCCTGTGGTTGGAGG - Intronic
1081356849 11:42122996-42123018 AGGAGTCAGCCAGAGAGTCTTGG - Intergenic
1083334549 11:61915086-61915108 AGGGGTGAGGCAGAGCTTGGGGG - Intronic
1087642002 11:100764956-100764978 AGGGGTCAGAAAGAGCTTTTTGG + Intronic
1091797791 12:3307104-3307126 GGGTGGCAGCCAGAGGTGGTGGG + Intergenic
1091854729 12:3730312-3730334 GAGGGTCAGCAAGAGGTGGTGGG + Intronic
1091995534 12:4990010-4990032 AGGGCTGAGCCAGAGAGTGTTGG + Intergenic
1093529613 12:20145526-20145548 AGGGGGCAGGCTGAGGTGGTAGG + Intergenic
1094535232 12:31315402-31315424 AGGGGTCAGCTTTAGTTTGTAGG + Intronic
1094853971 12:34394707-34394729 AGGGGCCAGCCTAAGGTGGTGGG + Intergenic
1095651497 12:44616127-44616149 AGGTGTCAGCTAGAGGATCTAGG - Intronic
1096749361 12:53748855-53748877 AAGGGTCAGGTAGAGGTTGCAGG + Intergenic
1098663288 12:73127145-73127167 AAGGATCAGAAAGAGGTTGTGGG + Intergenic
1100281141 12:93119553-93119575 AGGAGTGAGGCAGAGGTGGTGGG + Intergenic
1101771075 12:107751550-107751572 AGGAGACAGCCACAGGTTCTAGG + Exonic
1102924065 12:116813429-116813451 AGGGGTCAGCCAGATGGGGCTGG - Intronic
1105271772 13:18883260-18883282 AGTGGCCGGCCAGAAGTTGTTGG + Intergenic
1108581109 13:51828959-51828981 AGGGGTCAGAAAGGGGTTGGTGG - Intergenic
1110657216 13:78014379-78014401 AGGGGACACCCCGAGGCTGTAGG + Intergenic
1114547390 14:23512897-23512919 GGGGGTCTGGCAGAGGTTGGGGG + Intergenic
1118724631 14:68620331-68620353 AGGGGTCACGCAGAGGCTGTAGG - Intronic
1118838220 14:69491711-69491733 AGGGCTCAACCAGAGCTTGATGG - Intronic
1119264214 14:73254611-73254633 AGGGCTCAGTCAGAGGTGGCCGG - Exonic
1119854075 14:77886326-77886348 AGGGATCAGACAGAGGATGTGGG - Intronic
1119910609 14:78346181-78346203 AGAGATCAGCCAGAGGTTGTAGG - Intronic
1121019958 14:90573733-90573755 AGGGGTCAGCCAGGGCTTGGCGG - Intronic
1122025534 14:98873108-98873130 AGGGGTCTTTCAGAGGCTGTAGG + Intergenic
1123035678 14:105470956-105470978 AGGGGGCAGCAAGCGGTTGCAGG + Intergenic
1125540126 15:40465447-40465469 AGAGGCCAGCCAGAGGGTGCAGG - Intronic
1127852335 15:62924744-62924766 AGGGCTCAGCCTGTGGCTGTGGG - Intergenic
1129069740 15:72940764-72940786 AGGGCCCAGCCAGTGGTTGCTGG - Intergenic
1130368230 15:83259960-83259982 AGGGGAGAGGTAGAGGTTGTAGG - Intronic
1132718531 16:1304317-1304339 TGGGGCCAGCCAGAGGCTGAGGG + Intergenic
1138976803 16:62217519-62217541 AGGGGTCAGCAAAGGGTGGTGGG + Intergenic
1140447215 16:75039882-75039904 AGGGATCCTCCAGATGTTGTGGG + Intronic
1140773028 16:78223459-78223481 ATGGGTCTGCAAGAGGTTGATGG + Intronic
1140999475 16:80295080-80295102 AGGGATCAGACAGAGGTCGTGGG - Intergenic
1142698269 17:1645253-1645275 AGGGGTCAGCCGGACATGGTGGG + Intronic
1144401056 17:14902414-14902436 ATGGGTCAGGCAGAGGTTTGGGG - Intergenic
1144410264 17:14993967-14993989 AGGGGCAATCCAGAGGTTCTTGG - Intergenic
1144508600 17:15855957-15855979 TGGTGGCTGCCAGAGGTTGTGGG - Intergenic
1145172722 17:20673597-20673619 TGGTGGCTGCCAGAGGTTGTGGG - Intergenic
1146300547 17:31685854-31685876 AGGAGGCAGCCTGAGGCTGTGGG - Intergenic
1147744233 17:42685272-42685294 AGGGGTCAGCCGAAGCCTGTGGG + Exonic
1150207647 17:63420935-63420957 AGGAGTCAGCCAGAGCCGGTTGG + Exonic
1151669399 17:75563776-75563798 AGTGGTCAGCCAGAGGATTCTGG - Exonic
1151893717 17:76966429-76966451 TGGGGTAAGCCAGAGGCTGAGGG + Intergenic
1156484821 18:37457976-37457998 AGGTGTCAGGCTGAGGGTGTTGG + Intronic
1158138181 18:54228472-54228494 AGGGCACAGCCAGGGGTGGTGGG + Intergenic
1158675072 18:59511014-59511036 AGGGGTCAGACATAGGCTCTAGG - Intronic
1160851568 19:1195333-1195355 TGGGGTCAGCGAGGGGTTCTAGG + Intronic
1160851992 19:1197147-1197169 TGGGGTCAGCGAGGGGTTCTAGG + Intronic
1161412372 19:4123751-4123773 AGGGGTCAGCCGGAGGCTTGGGG - Intronic
1162129007 19:8513953-8513975 CGGGGTCGGCCGGAGGCTGTAGG + Intronic
1162609258 19:11737014-11737036 AGAGGACAGCCAGAGGTGGGGGG - Intronic
1162791040 19:13063082-13063104 AGGGGGCAGAGAGAGGTGGTGGG + Intronic
1165314456 19:35046147-35046169 AGGGGTCAGCCGGCAGTAGTTGG + Intronic
1165328082 19:35125753-35125775 GGAGTTCAGCCAGAGGTGGTGGG - Intronic
1165792484 19:38500395-38500417 AGGGGTCAGGATGAGGTTGGGGG + Intronic
1167191768 19:47995209-47995231 AGGGGACAGCCAGAGAAAGTAGG + Intronic
1167234296 19:48304211-48304233 CGGGGTCAGCCAGAGGTTGTGGG + Intronic
1167288259 19:48610895-48610917 AGGGGACACTCAGAGGGTGTGGG + Intronic
1167440902 19:49508265-49508287 AGGCCACAGCCAGAGGTTTTGGG - Intronic
1167525269 19:49979639-49979661 GCTGGTCAGCCAGAGGTTGGAGG - Intronic
1167586904 19:50380520-50380542 AGAGGTCCCCCAGAGATTGTGGG - Intronic
1167770567 19:51513030-51513052 AGGGGTCATCCACATGTTCTTGG - Intergenic
1168287094 19:55340438-55340460 AGGGGTCAGGGAGAGGTTCTAGG - Intronic
928451687 2:31383645-31383667 AGGGGGCAGCCAGAGCCAGTGGG + Intronic
929240774 2:39650973-39650995 AGGGGCCAGTCAGAGGGTGGGGG - Intergenic
929967210 2:46544159-46544181 AGGGACCAGACAGAGGCTGTGGG - Intronic
930054057 2:47238487-47238509 GGGGGGCAGTCAGAGGGTGTTGG + Intergenic
931837048 2:66110050-66110072 TGGGATCCGCCAGAGGTTGTGGG - Intergenic
933064782 2:77779664-77779686 AGAGATCAGCCAGGGGGTGTGGG + Intergenic
933949280 2:87314195-87314217 AAGGGGCAGCCAGGGGTTGAAGG + Intergenic
935096787 2:99952470-99952492 AGGGGTCTGCAAGAGGGTTTAGG - Intronic
935679615 2:105624672-105624694 AGGGCTCAGCCAGGTGTTGCTGG - Intergenic
936015890 2:108958822-108958844 AAGTGTCAGCCAGAGATAGTGGG + Intronic
936330916 2:111547402-111547424 AAGGGGCAGCCAGGGGTTGAAGG - Intergenic
937996605 2:127698969-127698991 AGGGGTTAGCTACAGGTTTTGGG + Intergenic
938137088 2:128768307-128768329 AGGGGTCAGCCAGAGTTTGAAGG - Intergenic
938451986 2:131429289-131429311 AGGGGAAAGCCAGAGGTAGAAGG - Intergenic
938551201 2:132383978-132384000 AGAGGTCTGCCTAAGGTTGTAGG + Intergenic
938551440 2:132386063-132386085 AGAGGTCTGCCTAAGGTTGTAGG + Intergenic
939041270 2:137191693-137191715 AGGGGTCAGAGAGAGCTTCTTGG - Intronic
940452751 2:153860582-153860604 AAGGGTCAGCAGGTGGTTGTTGG + Intergenic
946355422 2:219181545-219181567 AGGTGGAAGCCAGAGGTTTTGGG + Intronic
948761028 2:240191107-240191129 AGGGGTCACCCAGGGGTTCTAGG + Intergenic
1170164719 20:13349038-13349060 AGGGATCAGCCAGTGGTGGGAGG + Intergenic
1170780723 20:19423218-19423240 ACTGGTCATCCAGATGTTGTGGG + Intronic
1170857223 20:20068393-20068415 AGGGTTCAGTGAGAAGTTGTGGG + Intronic
1171180987 20:23090267-23090289 AGGGATCAGCCAAAGGGTGAAGG - Intergenic
1171360577 20:24583866-24583888 TGGGGCCTGCCAGAGGTTGGAGG + Intronic
1171449642 20:25226537-25226559 TGGGGTCAGCCCGAGGTGGGCGG - Exonic
1173667190 20:44771393-44771415 AGGGGACAGCCGGAGGCTGAAGG - Exonic
1174131205 20:48344446-48344468 AGGGGTAAGCCAAGTGTTGTGGG - Intergenic
1185408479 22:50671090-50671112 AGTGGTCACCCAGGGTTTGTGGG + Intergenic
949668060 3:6364545-6364567 AGGGGCCAGCCAGAGGGTGAGGG + Intergenic
949870764 3:8586427-8586449 AGGGTTCAGCCAGAGGCTTTTGG + Intergenic
953143916 3:40255262-40255284 TGGTGGCTGCCAGAGGTTGTGGG + Intronic
954871519 3:53770897-53770919 AGGTGTCAGAGAGAGGCTGTTGG - Intronic
955718406 3:61855784-61855806 AGGTGTAAGCCTGAGGTAGTTGG + Intronic
956028358 3:65008345-65008367 AGGGGTGAGCCTGAGGGTGAGGG + Intergenic
956192627 3:66621994-66622016 AGGGGGCTGCCAGAGGGTTTGGG + Intergenic
957169727 3:76722613-76722635 TGGGGCCAGCCTGAGGGTGTAGG - Intronic
958755219 3:98244213-98244235 AGGAGTCAGCCAAGGGTGGTGGG - Intergenic
961514174 3:127422675-127422697 AGGGGTCTGCTGGAGGTTGGTGG + Intergenic
961825864 3:129598716-129598738 GGGTGTGAGCCAGAGGGTGTCGG - Intronic
962358496 3:134715269-134715291 TGGGGTCAGCCAGAGGTTGAAGG + Intronic
962985396 3:140531546-140531568 AGGGGTCCTCCACAGGGTGTGGG + Intronic
964131116 3:153288049-153288071 AGAGGTCAGCCAGCCTTTGTGGG + Intergenic
965724923 3:171705047-171705069 GGAGGTGAGCCAGAGCTTGTCGG - Intronic
966727385 3:183119754-183119776 TGGGGTCAGCCAAAGCATGTTGG + Intergenic
967223926 3:187273533-187273555 AGGAGTCAGCCCGGGGCTGTCGG - Intronic
968970676 4:3791920-3791942 AAGGGACAGCCAGAGGGTTTGGG + Intergenic
969343742 4:6558465-6558487 AGGAGGCAGCCAGAGGTGGCAGG - Intronic
969576572 4:8039418-8039440 AGGGGTCGGGCAGGGGCTGTTGG - Intronic
970298014 4:14652201-14652223 AAGGCTCAGCCTGAGGTTCTTGG + Intergenic
971077315 4:23164908-23164930 AGAGGACAGCCATAGGTGGTTGG - Intergenic
975267164 4:72383556-72383578 AGGGGTCAGCCAGAGGTTGTTGG - Intronic
975619808 4:76285016-76285038 AGGGGCCAGCCAGAGGGTGGAGG - Intronic
976567717 4:86570833-86570855 AGGAGTCACCAAGAGGTTGGAGG + Intronic
977690702 4:99906328-99906350 AGAGGTCAGCCAGGGGTGGTTGG - Intronic
979585655 4:122413000-122413022 AGGTGGGAGGCAGAGGTTGTGGG + Intronic
985452794 4:190070231-190070253 AGGGCTCAGCCTGGGGATGTGGG - Intergenic
985453780 4:190073524-190073546 AGGGCTCAGCCTGGGGATGTGGG - Intergenic
985454769 4:190076817-190076839 AGGGCTCAGCCTGGGGATGTGGG - Intergenic
985509913 5:307606-307628 TGGGGCCAGCCTGAGGCTGTTGG + Intronic
985794308 5:1950493-1950515 AGGCGTCTCCCAGTGGTTGTGGG - Intergenic
985974086 5:3401636-3401658 AGGGCTGAGCCAGAGGCTGGTGG - Intergenic
988794521 5:34640225-34640247 TGGAGTCAGCTAGAGATTGTTGG - Intergenic
990064507 5:51696195-51696217 TGGGTTCAGACAGTGGTTGTTGG + Intergenic
990350553 5:54911529-54911551 GGGGGTCAGGCAGAGGCAGTGGG - Intergenic
990417102 5:55597156-55597178 GGAGGTCAGCCAGGGGTTGGTGG - Intergenic
991113633 5:62928979-62929001 AGGAGTCAGCAAAGGGTTGTGGG - Intergenic
991442784 5:66668811-66668833 AGGGGGAAGCCAGAGGTGGGAGG + Intronic
995039781 5:107574478-107574500 ATGGAGAAGCCAGAGGTTGTTGG - Intronic
999872838 5:155770343-155770365 AGGAGCCAGCCATAGGATGTGGG + Intergenic
1001690574 5:173629753-173629775 AGGGGTAACCCTGAGGTTGGGGG - Intergenic
1007276232 6:40676149-40676171 AGGGCACAGGCAGAGGTTGAAGG - Intergenic
1008219429 6:48837626-48837648 AGGGGTCAGCAAAGGGTGGTGGG - Intergenic
1008548239 6:52602743-52602765 AGGGGTCAGATAAAGGTTGATGG + Intergenic
1009920001 6:70045660-70045682 AGGAGTCAGCCAGAGATTTGGGG + Intronic
1012306810 6:97669101-97669123 AGGGGTGGGCCAGAGGGTGGGGG - Intergenic
1015944800 6:138488969-138488991 AGGGGTCTTTCAGAGGTTGATGG + Intronic
1018757080 6:166859295-166859317 ATGGGTCAGCCAGACCTTGTGGG + Intronic
1024291424 7:47807373-47807395 AGGGGTGAGAGGGAGGTTGTGGG + Intronic
1029097940 7:98104090-98104112 AGGCCTCAGCCAGAGCTTGCTGG + Intergenic
1029839378 7:103345974-103345996 AGGGATCAGGAAGAGGTTTTGGG - Intronic
1032085303 7:128880573-128880595 AGGGGTAAGCCAGACCTTCTGGG - Intronic
1032338333 7:131046863-131046885 AGTGGTCAGCCAGTGGATTTGGG + Intergenic
1034243185 7:149624895-149624917 AGGGGTCGGCCAGGGGTCGCGGG - Intergenic
1034283852 7:149871695-149871717 AGGGAACAGCCAGGGCTTGTGGG + Intergenic
1034417470 7:150972600-150972622 AGGGGACAGACAGAGATTGCTGG + Intronic
1034588753 7:152120484-152120506 GAGGGTCAGCCAGAGGCTGTCGG + Intronic
1039424887 8:37477599-37477621 AGGGGTCAGACAAGGGTTGGGGG - Intergenic
1039845257 8:41321420-41321442 AGGGGAAGGCCAGAGGTGGTCGG - Intergenic
1042735038 8:71978629-71978651 AGGGGTCAGAAAGAGATAGTAGG - Intronic
1045109960 8:98931009-98931031 ATGGGTCAGACAGAAGCTGTGGG - Intronic
1045259515 8:100559774-100559796 AGGGGCCAGACAGGGGTAGTCGG + Intronic
1045932736 8:107646257-107646279 AGTGGTTTGCCAGAGGCTGTCGG - Intergenic
1046074628 8:109301378-109301400 AGGAGTCAGCAAGGGGTGGTGGG - Intronic
1046119337 8:109825750-109825772 AGGGGTCTTTCAGAGGGTGTAGG - Intergenic
1049253533 8:141602026-141602048 AAGGGCCAGCCAGAGGTAGAAGG - Intergenic
1051300291 9:15643419-15643441 AAGGGTCCCCCAGAGGTTGTAGG - Intronic
1052953967 9:34238007-34238029 AGGAGGCTGCCAGAGGCTGTGGG - Intronic
1052978709 9:34431178-34431200 AGGGGTGAGGCAGAGGATCTTGG + Intronic
1054952344 9:70866665-70866687 AGTGGCCAGCCAGGGCTTGTGGG - Intronic
1055878098 9:80967188-80967210 AGTGGTTTGCCAGAGGTTCTCGG + Intergenic
1056422923 9:86447187-86447209 AGGGGTCAACCTGAGGCTGTAGG + Intergenic
1056787164 9:89601534-89601556 ACCAGTCAGCCAGAGGCTGTGGG - Intergenic
1060187189 9:121570881-121570903 AGGGGCCAGCCAGAGATAATGGG - Intronic
1060617752 9:125034193-125034215 AAGGGTCAGCAGGAGGTTGGAGG - Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061571050 9:131477622-131477644 AGGAGTCAGCTAGAGGAAGTGGG + Intronic
1061995190 9:134179631-134179653 AGGTGTCAGCCAGGAGTTCTGGG + Intergenic
1062010551 9:134264572-134264594 AGAGGTCAGCTAGAGGTGCTGGG + Intergenic
1062056658 9:134472510-134472532 AGAGGTCAGTCAGAGGTGGGAGG + Intergenic
1062458597 9:136653253-136653275 AGGGGTCAGGCAGAGTGTGAGGG + Intergenic
1062597121 9:137304410-137304432 CGGGGTCAGGCAGAGGTGGTGGG + Intergenic
1186486223 X:9936396-9936418 AAGTGTCAGCCAGATGTGGTGGG - Intronic
1187051587 X:15701748-15701770 TGGGGTCAGCCAGTAGTTGCAGG - Intronic
1187954222 X:24500052-24500074 AGTGGTCAGCCCTAGGTTTTAGG - Intronic
1188671796 X:32889771-32889793 AGGAGTCAGCCAAGGGTGGTGGG - Intronic
1188890797 X:35609706-35609728 AGGAGTCAGCCAAGGGTGGTGGG - Intergenic
1190942856 X:55059772-55059794 AGGGGTTGGCAGGAGGTTGTAGG - Intergenic
1191896531 X:65999032-65999054 AGGAGTCAGCCATGGGTTGAAGG + Intergenic
1192215250 X:69153507-69153529 AGGGGTCAGACTGGGGTTCTGGG + Intergenic
1193354918 X:80508119-80508141 AGGGGTTTGCCAGGGGTTCTCGG - Intergenic
1193450171 X:81655723-81655745 AGTGGTTTGCCAGAGGTTCTTGG - Intergenic
1198499094 X:137224819-137224841 AGGGGGCAGCCAGAGGAAGAGGG - Intergenic
1199552030 X:149070931-149070953 ACGGGTGAACAAGAGGTTGTGGG + Intergenic
1199875037 X:151922215-151922237 AGGGGACAGCCAGACTCTGTGGG - Intronic
1199894340 X:152116984-152117006 AGGGGACAGCCAGACTCTGTGGG + Intergenic
1201970807 Y:19792548-19792570 TGGGGTCAGTCAGGGGTTGAGGG - Intergenic