ID: 975268728

View in Genome Browser
Species Human (GRCh38)
Location 4:72403441-72403463
Sequence CAATATCTGCAGATATTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975268724_975268728 22 Left 975268724 4:72403396-72403418 CCTTTTTACTCACACATAAAATT 0: 1
1: 1
2: 6
3: 61
4: 613
Right 975268728 4:72403441-72403463 CAATATCTGCAGATATTAGATGG 0: 1
1: 0
2: 3
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975268728 Original CRISPR CAATATCTGCAGATATTAGA TGG Intronic
900118561 1:1039014-1039036 CAGTATCTGCAAAGCTTAGAGGG - Intronic
900905282 1:5552751-5552773 CAATATCAGCAGATCATACAAGG + Intergenic
905001683 1:34676340-34676362 CAATGTCTGAAGATATTATTTGG + Intergenic
905948513 1:41924851-41924873 CAATGGCTTCAGATATTTGAAGG - Intronic
907643877 1:56221189-56221211 CAAAATATGCACATATTAGCTGG + Intergenic
908920663 1:69187427-69187449 CAAAATAGACAGATATTAGATGG + Intergenic
909226875 1:73036256-73036278 CAATTTCTGCTGGTATTTGAAGG + Intergenic
909371332 1:74886097-74886119 CAAGATCTGAAGGTATTATAAGG + Intergenic
911973735 1:104466139-104466161 TACTAGCTGCAGCTATTAGAGGG - Intergenic
913141657 1:115947163-115947185 CAAGATCTTCAGAGATTTGAAGG + Intergenic
913484505 1:119321684-119321706 AAATATCTACAGAGAGTAGATGG + Intergenic
916086655 1:161275160-161275182 CAAGGTCTGCTGATATGAGAAGG + Intronic
917014219 1:170511336-170511358 AAATATTTGCAGAAATCAGAGGG - Intergenic
917321808 1:173790396-173790418 CAATATCTGGCTATATTAGAAGG - Intergenic
918170337 1:181990501-181990523 AAATCTTTGCTGATATTAGAGGG + Intergenic
919186913 1:194162819-194162841 CAACATCAGCAGATATTTAAGGG + Intergenic
919317258 1:195987789-195987811 CAATGTCTGCAAATACTATATGG - Intergenic
919405739 1:197180790-197180812 CAAGATTTGCAGGTTTTAGATGG - Intronic
919524108 1:198625955-198625977 CAATATCCTCAAATATAAGATGG - Intergenic
920575630 1:207058067-207058089 CAATATTTTAAGATATTTGATGG + Intronic
921747317 1:218753023-218753045 TACTAGCTGCAGCTATTAGAGGG - Intergenic
921899998 1:220439871-220439893 CAAGCTCTGCATATATTAGAAGG + Intergenic
922432833 1:225572498-225572520 CAAAATCTGCAGATAATAGAGGG - Intronic
924541992 1:244989865-244989887 CAAGATCTGAAAATATTAAATGG + Intronic
1064300437 10:14118359-14118381 AAATTTCTGCAGAAATTTGATGG + Intronic
1065592159 10:27274895-27274917 CGAATTCTGCAGATATTAAAAGG - Intergenic
1065658199 10:27975455-27975477 CAAATTCTACAGATATTAAAAGG + Intronic
1068521274 10:58080171-58080193 CAATATCTTCACATATAAAATGG + Intergenic
1068664036 10:59653611-59653633 CTATATCTGGAGATATGACAAGG + Intronic
1068831742 10:61504111-61504133 CAATTTCTGTACATATTAGCAGG + Intergenic
1068998831 10:63240544-63240566 CAATAACTGAAGATATTATTGGG + Intronic
1069948698 10:72004807-72004829 CAATGTCTGGAGATATTTGATGG + Intronic
1074021661 10:109590745-109590767 CATTATCTTCAAATACTAGATGG + Intergenic
1074567372 10:114592829-114592851 TGATATCTGCTGAAATTAGAAGG + Intronic
1075951434 10:126481131-126481153 CAAGATCTGCAGATGATGGAAGG - Intronic
1078121052 11:8509151-8509173 CAATATGTTCAGACATTAAATGG + Intronic
1081182625 11:40003121-40003143 CAAGCTCTGCAGACATTTGAAGG - Intergenic
1082291507 11:50379070-50379092 CAATATCTTCAGATAAAAGCTGG + Intergenic
1084932307 11:72566482-72566504 CAATATTTACAGATACCAGAGGG - Intergenic
1085295780 11:75430878-75430900 CGATATCTGCAGGTAACAGATGG + Intergenic
1086228809 11:84544106-84544128 CAATATCTTCAGTTAACAGATGG - Intronic
1087411393 11:97794037-97794059 CAATATATGCAAATATTCGGTGG + Intergenic
1088196309 11:107277784-107277806 CAATGGCTGCAGATTTTTGAGGG - Intergenic
1089889850 11:121870083-121870105 CACTTTCTGCAGAAATGAGAAGG + Intergenic
1091905370 12:4182072-4182094 CAATTTCTCCAGAAAATAGAAGG + Intergenic
1092438248 12:8471595-8471617 AAATATCTGCAGAAATAAAAGGG - Intronic
1092550019 12:9487882-9487904 CAATATCTGGAAAAATTGGAAGG - Intergenic
1095038034 12:37414873-37414895 CAATATCTACAAATATCCGAAGG - Intergenic
1095763180 12:45864195-45864217 CAATATGTGATGATATAAGAGGG - Intronic
1100975090 12:100113924-100113946 CTTGATCTGCAGGTATTAGATGG + Intronic
1104816788 12:131651029-131651051 CAATATTTGCAGATATATCATGG + Intergenic
1105584751 13:21733697-21733719 CATTAGCTTCAGAGATTAGAAGG + Intergenic
1106262901 13:28083795-28083817 CATAATCTACAGATATTAAACGG - Intronic
1109422910 13:62137185-62137207 CAAATTCTGGAGAAATTAGATGG - Intergenic
1109745646 13:66620307-66620329 GAATATTTTCAGATATTAGTAGG + Intronic
1110686903 13:78386225-78386247 CAAAAACTGCAGAAATTAGCTGG + Intergenic
1112489182 13:99846903-99846925 CAATTTCTGCAGGTATGAGTTGG - Intronic
1112524995 13:100136720-100136742 CAAACTATGCAGATATTAAAAGG - Intronic
1113010164 13:105755227-105755249 CAATATCTGCAGACAGCAAATGG + Intergenic
1114367017 14:22039921-22039943 CAAAATTGGTAGATATTAGAAGG - Intergenic
1116650387 14:47584200-47584222 CACAATGTGCAGATAATAGAAGG - Intronic
1117783695 14:59260234-59260256 GATTATCTGCTTATATTAGAGGG - Intronic
1119291431 14:73498339-73498361 CCAAAGCTGCAGAGATTAGAGGG + Exonic
1119450273 14:74703311-74703333 CAATATCTGTTGATTTTATAAGG - Intronic
1120976444 14:90253302-90253324 CATTCTGTGCATATATTAGATGG - Intergenic
1123002288 14:105301774-105301796 CAGCACCTGCAGATATTTGAGGG - Exonic
1124409661 15:29426287-29426309 CAACATTTGCATATTTTAGAAGG - Intronic
1126636374 15:50784243-50784265 AAATAACTGCTGATATTTGAGGG - Intergenic
1128957519 15:71964079-71964101 CATAACCTACAGATATTAGAAGG - Intronic
1130236364 15:82138240-82138262 AAATATCTCCAGTAATTAGAGGG - Intronic
1130658423 15:85810142-85810164 CAGTATCTGAAAATATTAAATGG + Intergenic
1130774996 15:86969687-86969709 ATATATCTGCAGATATTTGTTGG + Intronic
1133991418 16:10710425-10710447 TAATATCCGAAGATATGAGAGGG - Intergenic
1136541822 16:30931645-30931667 CAATCTCTGCAGATACCAGAAGG - Intronic
1138273523 16:55713391-55713413 CAATATCTACAGAAATTTGCAGG + Intergenic
1138775707 16:59721298-59721320 GAATAGATGCAGATATTAGATGG + Intronic
1140960174 16:79904140-79904162 CAATGTCTGCAGACATTATAGGG + Intergenic
1140969966 16:80003339-80003361 CAGTATCTACCAATATTAGACGG + Intergenic
1145407543 17:22618038-22618060 CAAAATGTCCATATATTAGATGG + Intergenic
1146890654 17:36504365-36504387 CACTGTCTGCAGGCATTAGAGGG + Intronic
1147746080 17:42695504-42695526 CAATATCTGCAGGTAGAAGCAGG - Exonic
1151866344 17:76805927-76805949 CAATATCTGCACATAATAACAGG - Intergenic
1154462926 18:14613797-14613819 CACTATCTGCAACTATTAGTAGG - Intergenic
1156406722 18:36789790-36789812 CAAGATCTGCTGATTTTATAAGG + Intronic
1156583479 18:38406527-38406549 CAATATGTGCCAATATTTGAGGG - Intergenic
1158107489 18:53902341-53902363 CTGTCTCTGCAGATATTATAAGG - Intergenic
1158671071 18:59474275-59474297 CAGGATCATCAGATATTAGAGGG - Intronic
1159102477 18:63971198-63971220 CAATATCTGGAGGTAGTAAAAGG - Intronic
1159124967 18:64212287-64212309 GAATATTTGCAAATATTAGGAGG + Intergenic
1159399438 18:67911578-67911600 CAGTATGTGCAGAAATTACATGG - Intergenic
1160042386 18:75357517-75357539 CAAGATCTGAAGATATGAAATGG - Intergenic
1161999663 19:7735266-7735288 CATTCTCTGCAGAGATGAGAGGG + Intergenic
1162006455 19:7783479-7783501 CATTCTCTGCAGAGATGAGAGGG - Intergenic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1167045005 19:47044696-47044718 CAATATCTGGAGATATTTTGGGG - Intronic
927035305 2:19168758-19168780 CAATAGCTGGAAATATTACAAGG + Intergenic
928954339 2:36847294-36847316 CAGTAACTGAAGATCTTAGAAGG + Exonic
929349070 2:40926108-40926130 TAATATTTGCAGATATAAGGAGG - Intergenic
929807897 2:45163134-45163156 CAATATCTGCTGATTTTATTTGG - Intergenic
931826824 2:66008924-66008946 CAATATCTTCAGATTGTATAGGG + Intergenic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
933051174 2:77604405-77604427 CAAGATCTTCAGATTTTAGTTGG + Intergenic
933223236 2:79715298-79715320 TAACATCTGCAGATATTTGAAGG + Intronic
933303451 2:80568795-80568817 CAATATCTCCAAATATGAAATGG - Intronic
935734213 2:106093838-106093860 CAAAATCTGCAGTTTTTTGAGGG + Exonic
935833409 2:107023877-107023899 CAATATCTGCACATGCCAGATGG + Intergenic
938644136 2:133314227-133314249 CAAGACCTGCAAATAATAGATGG + Intronic
939732150 2:145798034-145798056 TAATATTTTCAGATATTAGTAGG + Intergenic
941574180 2:167210165-167210187 CAATATTTGCATATTTTAGCTGG + Intronic
942186192 2:173427140-173427162 CTATATCTGCAGGAATTTGATGG + Intergenic
942686511 2:178538341-178538363 CAACCTCAGCAGATGTTAGATGG - Intronic
943142892 2:184004901-184004923 CATTATTTTAAGATATTAGAGGG - Intergenic
943798657 2:192030251-192030273 GAATCTGTTCAGATATTAGAAGG + Intronic
944363660 2:198890938-198890960 CAATAACTACAGATAATAGAGGG - Intergenic
1169640894 20:7750965-7750987 CATTATCTCCAGACCTTAGAGGG + Intergenic
1170659342 20:18321503-18321525 CATTTTCTGCATATGTTAGAAGG - Intergenic
1171315489 20:24188683-24188705 GAATATCTGCATATATTATTTGG + Intergenic
1172459295 20:35103848-35103870 CAAAATCTGATGATTTTAGAAGG + Intergenic
1174920884 20:54700794-54700816 AAATATTTTCACATATTAGATGG + Intergenic
1176368279 21:6046703-6046725 CAATGGCTGCAGAAATTAGGAGG + Intergenic
1176811600 21:13544575-13544597 CACTATCTGCAACTATTAGTAGG + Intergenic
1177464308 21:21455810-21455832 AAATATCTAGAGAGATTAGAAGG + Intronic
1177929014 21:27256869-27256891 TAATATCTTCATATATTAAATGG - Intergenic
1179755240 21:43491839-43491861 CAATGGCTGCAGAAATTAGGAGG - Intergenic
1184543540 22:45148154-45148176 CAATAAATGCAGAGCTTAGAAGG - Intergenic
950908264 3:16558763-16558785 TAATATCTACAGATATTAAAAGG + Intergenic
951445784 3:22778889-22778911 CCACATCTGAAGATACTAGAAGG + Intergenic
951976780 3:28519650-28519672 CATGAACTGCAGATAATAGAAGG + Intronic
953270712 3:41440953-41440975 CAAATTCTACAGATATTAAAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956498773 3:69859028-69859050 CAAGATCTGCATCTATAAGATGG - Intronic
957574350 3:81988984-81989006 AAATATCTAAAGTTATTAGAAGG - Intergenic
958540582 3:95465415-95465437 TAATATCTGCTGATAGTAGCAGG - Intergenic
960591260 3:119368153-119368175 CAAAATCTGCTGTGATTAGAAGG - Intronic
961076642 3:123988948-123988970 TAACATCTGCAGGTATTAGAAGG + Intronic
961105108 3:124234062-124234084 CAATTTCTGTTGCTATTAGAAGG - Intronic
961567708 3:127775625-127775647 AATTATCTGCAAATATTTGAGGG - Intronic
962183391 3:133232380-133232402 CAATATGTGCAGAGATCACATGG - Intronic
962724242 3:138206623-138206645 CAATTTGTACAGATATTAAATGG - Intronic
962939193 3:140110105-140110127 CAATATTTGCAGATTTTAAGAGG - Intronic
963229226 3:142892992-142893014 AAATATCTCCAAATATTAAAAGG + Intergenic
963238492 3:142979404-142979426 CAATATGTGCAGATATCACATGG - Intronic
963406324 3:144868259-144868281 CATTATGTGCAGAGATTACATGG - Intergenic
964301803 3:155296018-155296040 CTATATATGCATATATTATAAGG - Intergenic
964987447 3:162761891-162761913 CAATCCTTGCAGATATTAAAGGG - Intergenic
966830191 3:184001546-184001568 CAATATCTGGAAATGTTTGAGGG + Intronic
967006070 3:185383618-185383640 CAGTATGTGCAGAAATTACATGG - Intronic
967144426 3:186594448-186594470 GAATATCTGCAGAGAATACATGG + Intronic
970730568 4:19098593-19098615 CAATACCTGCTGATATTGTAGGG + Intergenic
972479768 4:39486261-39486283 CAGAAGCTGCAGAAATTAGAAGG + Intergenic
973208130 4:47583529-47583551 TAATATCTGCAAATACCAGATGG + Intronic
973596347 4:52494333-52494355 CAATATCTGATGGTATTATAAGG + Intergenic
975268728 4:72403441-72403463 CAATATCTGCAGATATTAGATGG + Intronic
975286732 4:72630056-72630078 CATGATCTGCACATATTGGAAGG - Intergenic
975937743 4:79601691-79601713 CAATATGTGCAGAGATCACATGG - Intergenic
977598192 4:98907181-98907203 CTATATCTACATATATCAGAAGG - Intronic
979561337 4:122105267-122105289 AAATGTATGCAGATATTTGAGGG + Intergenic
980652818 4:135742416-135742438 CAGAATTTGCAGATATTAGTAGG - Intergenic
981179589 4:141724626-141724648 CAGAATCTGCAGTCATTAGAAGG + Intronic
982039563 4:151383032-151383054 CAATATTTCAAAATATTAGAGGG + Intergenic
984086265 4:175315669-175315691 CAATATCTGCTAATATTATTAGG - Intergenic
984167887 4:176324570-176324592 GAATATCTGCATATTGTAGAAGG - Intronic
985043239 4:185913994-185914016 CAATAACTGAACATATTTGAAGG - Intronic
985275202 4:188231378-188231400 CAATGTGTGCAGATATTCAAAGG - Intergenic
986482293 5:8202022-8202044 TAATATCTTCAGTTTTTAGAGGG - Intergenic
987439635 5:17940441-17940463 CAAGAGATGCAAATATTAGAAGG + Intergenic
987753618 5:22071904-22071926 CAAAATCTGCAGAAATTAGTGGG - Intronic
989845821 5:46139583-46139605 AAATATCTTCAGATAAAAGATGG + Intergenic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
991563611 5:67981813-67981835 CACTTTCTGAAGATATTAGCAGG + Intergenic
992788267 5:80190519-80190541 CAATACCTGCACATAGTAGTTGG - Intronic
993196622 5:84756925-84756947 CATTATTTGCTGCTATTAGAAGG - Intergenic
993995950 5:94723383-94723405 CAAAATTTTGAGATATTAGAGGG + Intronic
995167154 5:109057439-109057461 CAGAATATTCAGATATTAGAAGG + Intronic
996460670 5:123737904-123737926 CAATATTTGCAGGTATTGTAAGG + Intergenic
997139089 5:131360065-131360087 CAATATGTGCATATATTAGAGGG - Intronic
997392464 5:133528296-133528318 CAATATGAGCAGATGTTAAATGG - Intronic
997516586 5:134494243-134494265 GTATTTCTGCAGATATTAAAAGG + Intergenic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
1001360748 5:171083786-171083808 CAACATCTGATGATATTATAAGG + Intronic
1004110299 6:12711403-12711425 CAATGTCTCAACATATTAGATGG + Intergenic
1004244380 6:13959001-13959023 CGATATCTGCAGAGATCACATGG - Intronic
1004968050 6:20877322-20877344 AAATCTCATCAGATATTAGATGG - Intronic
1006561262 6:34914721-34914743 CAGTTTCTGCAGAACTTAGAAGG + Intronic
1007512767 6:42387000-42387022 CAATGTCTGCAGATATTTTTGGG - Intronic
1009631112 6:66202334-66202356 CAATATCTACAAAAATTAGTAGG + Intergenic
1009689175 6:67005029-67005051 CAATATCTAGATATATTAGCAGG - Intergenic
1009795956 6:68467925-68467947 AAATATCTGTAGATATTTTATGG - Intergenic
1009988538 6:70811836-70811858 TATTCTCTGCAGATATGAGAGGG - Intronic
1010258379 6:73786948-73786970 CACTATCTGAAGCCATTAGATGG - Intronic
1010684328 6:78834189-78834211 CAATATCTACAGCTCTTAGCTGG - Intergenic
1010874916 6:81090595-81090617 GAATATCTGCACATATTTGAAGG - Intergenic
1011564962 6:88664539-88664561 TACTAGCTGCAGCTATTAGAGGG + Intronic
1014104882 6:117550396-117550418 CAATATCAGCATATATGATAAGG + Intronic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1015667852 6:135651336-135651358 CAAGATCTGATGATATTATAAGG + Intergenic
1020681960 7:11247913-11247935 AAATATTTAGAGATATTAGATGG + Intergenic
1023629212 7:42146931-42146953 CTGTATCTGCAGAAATAAGATGG + Intronic
1026370717 7:69696033-69696055 GAATATATTCAGATATTAAAGGG - Intronic
1027787133 7:82594466-82594488 CAATATCTCCAGATTTGAGCTGG + Intergenic
1027958380 7:84911825-84911847 AAATATTTGTAGATACTAGAAGG - Intergenic
1028356064 7:89910417-89910439 CAATGTTTGCAAATATTAAAAGG + Intergenic
1028545150 7:91990840-91990862 CATTATCTGAAAATATTAAATGG + Intronic
1029335417 7:99894885-99894907 CAGATTCTGCAGATATTAAAAGG - Intronic
1032190680 7:129763870-129763892 CCATCTTTGCAGATCTTAGATGG - Intergenic
1033811088 7:145012000-145012022 CAATAAATGTAAATATTAGATGG + Intergenic
1037218090 8:16482908-16482930 GAAGATCTGCAGGTATTAGCAGG - Intronic
1037629569 8:20641733-20641755 CATGATCTGCAGTTATTAAAAGG - Intergenic
1037739437 8:21595274-21595296 CAGATTCTGCAGATATTAAAAGG + Intergenic
1038853707 8:31307551-31307573 CAATATCAGCAGTTATTATGAGG - Intergenic
1042999114 8:74735468-74735490 AAAGTTCTGCAGATACTAGAAGG + Intronic
1043622302 8:82209828-82209850 CAATATATAAACATATTAGAAGG + Intergenic
1043738987 8:83784394-83784416 CAATATCTGCTCATTTTATAAGG + Intergenic
1045673727 8:104586784-104586806 CTATATCAGCAGAGATTAAAGGG - Intronic
1047920096 8:129626520-129626542 TAATATTTGCTGATATTATAAGG - Intergenic
1050626115 9:7505194-7505216 CAAAATCTGCAGATATTCCAGGG + Intergenic
1050685429 9:8163554-8163576 TAAGTTCTGCAGACATTAGAGGG + Intergenic
1051050797 9:12929596-12929618 AAACATTTGCAGATATTACATGG - Intergenic
1052483844 9:29069667-29069689 CAAAAGCTTCAGATATTAAAAGG - Intergenic
1055528939 9:77164033-77164055 CAATGTCTTCAGACATTCGACGG - Intergenic
1058024122 9:100121532-100121554 CAAAGCCTGCAGATATTAAAAGG - Intronic
1058245289 9:102615619-102615641 CAATATCTGCAGAAATCATATGG - Intergenic
1058297485 9:103327156-103327178 CAAGATGTGCAGATATTAAGGGG - Intergenic
1058500986 9:105616126-105616148 CACGATCTGAAGATATTAAATGG - Intronic
1185923184 X:4116696-4116718 TAATGTCTGTAAATATTAGATGG - Intergenic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1186038480 X:5449880-5449902 CAATAGCTGCATAGAGTAGATGG + Intergenic
1186054562 X:5635216-5635238 CAAGATCTGATGATGTTAGAAGG + Intergenic
1187204780 X:17171495-17171517 ATATATGTTCAGATATTAGAAGG - Intergenic
1188272720 X:28160625-28160647 AAATTTTTGCAGACATTAGAAGG + Intergenic
1188769700 X:34137184-34137206 AAATTTCTGCATATACTAGATGG + Intergenic
1188868859 X:35348820-35348842 CAAGGCCTGCAGATATTACAGGG + Intergenic
1189151352 X:38710903-38710925 CAAATTCTGCAGATATTGAAAGG + Intergenic
1189164676 X:38849254-38849276 TCACATCTGCAGATATTAGGTGG - Intergenic
1189678180 X:43486133-43486155 CAAATTCTGCAGATATTAGAAGG + Intergenic
1190681779 X:52831884-52831906 CAATGTCTGCAGCTCTTAGCAGG - Intergenic
1191942810 X:66498999-66499021 AAATAACTGCAAGTATTAGAAGG - Intergenic
1192657466 X:73006023-73006045 CAATATCTGCATATTTTATGAGG - Intergenic
1193874008 X:86837694-86837716 CAATATCTGCAACTATGTGAAGG + Intergenic
1194663733 X:96655059-96655081 CAACTTCTGAAGATATTGGATGG - Intergenic
1195380362 X:104264840-104264862 CAATATCTGGAGATATTTTTGGG + Intergenic
1195605843 X:106804494-106804516 AAATATCTGCATCTATTAAATGG - Intronic
1196574643 X:117303857-117303879 CAATCTCTGCTCATTTTAGAGGG - Intergenic
1196673931 X:118399503-118399525 CAATAACTGCAACTACTAGATGG - Intronic
1198112313 X:133512679-133512701 CAATATCAGCAGGAATTGGACGG + Intergenic
1199661482 X:150054777-150054799 CAATATCTGCAGAACATAGCAGG + Intergenic
1200735634 Y:6791184-6791206 CAGAGTCTACAGATATTAGAAGG - Intergenic
1201633009 Y:16090931-16090953 CAATAGCTGCATAGAGTAGATGG - Intergenic