ID: 975270381

View in Genome Browser
Species Human (GRCh38)
Location 4:72425475-72425497
Sequence TGGGGTAAGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23542
Summary {0: 2, 1: 65, 2: 1066, 3: 11025, 4: 11384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975270381_975270391 -10 Left 975270381 4:72425475-72425497 CCCTCCCCCTTCCCCTTACCCCA 0: 2
1: 65
2: 1066
3: 11025
4: 11384
Right 975270391 4:72425488-72425510 CCTTACCCCACAACAGGTCCCGG 0: 2
1: 15
2: 375
3: 3326
4: 4537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975270381 Original CRISPR TGGGGTAAGGGGAAGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr