ID: 975273486

View in Genome Browser
Species Human (GRCh38)
Location 4:72466265-72466287
Sequence ATGTAGAAGAAGAGGCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975273478_975273486 29 Left 975273478 4:72466213-72466235 CCATAGAGAAAGCACTGTTCAGC 0: 1
1: 0
2: 1
3: 14
4: 184
Right 975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975273486 Original CRISPR ATGTAGAAGAAGAGGCTAGA GGG Intronic
901826144 1:11862821-11862843 ATGCACAAGCAGAGGCTAGAAGG + Intergenic
901913594 1:12480411-12480433 AGGTAGGAGAAGAGACTAAATGG + Intronic
902077628 1:13800504-13800526 ATGTGGAGGAAGAGGGGAGACGG + Intronic
903289461 1:22298815-22298837 AAGAAGAAGAAGAGCCGAGAGGG + Intergenic
903406328 1:23099895-23099917 ATGTAGATGAAGAGGCTGGCGGG - Intronic
906944333 1:50283002-50283024 ATGTTGAAGATGAGGGCAGAGGG - Intergenic
907119620 1:51996853-51996875 AAAGAGAAGAAGAGGCCAGATGG + Intergenic
908243658 1:62210021-62210043 AAGAAGAAGAAGAGGCTTCAGGG + Exonic
909067437 1:70952330-70952352 ATGTAGTAGAAGGGGCTTTAAGG - Intronic
909361991 1:74771385-74771407 ATGTACAAGATGAGCCTGGAAGG - Intergenic
909647048 1:77929434-77929456 AAGCAGAAGAAGAAGCCAGAAGG + Exonic
909773566 1:79456916-79456938 ATATAGAAAAAGAGGCTTAATGG - Intergenic
910609118 1:89121271-89121293 CTGTAGAAGGAGAGGATAAAAGG + Intronic
912145954 1:106794795-106794817 AACTATCAGAAGAGGCTAGAGGG + Intergenic
912573300 1:110640738-110640760 AACTAGAGAAAGAGGCTAGATGG + Intergenic
914964025 1:152237076-152237098 AGGTAGAAGAAAAGGCAGGAAGG - Intergenic
915339631 1:155169546-155169568 ATGGAGAAGATGAAGCTATATGG + Exonic
915910700 1:159913545-159913567 TTGTTGAAGAAAAGGCTAAAAGG - Intergenic
916260353 1:162835729-162835751 TTGGAGAAGGAGAGGCTACAAGG - Intronic
917133590 1:171766502-171766524 ATGGAGAAGAAGAGGCCACTGGG + Intergenic
917232308 1:172851586-172851608 ATGTAGATGAATAGCTTAGAAGG - Intergenic
917628233 1:176867308-176867330 AGGGAGAAGAAGAGGGGAGAGGG + Intronic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
920114465 1:203610174-203610196 ATGAAGAAGCAGAGGCCAGAGGG + Intergenic
920132303 1:203741611-203741633 ATCCAGAAGAAAAGGCTAGGTGG - Exonic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
921532442 1:216301380-216301402 ATGTTGAAGAAGTGCCTAGAAGG + Intronic
921556323 1:216602254-216602276 ATTTACTAGAAGAGGCTAAAGGG + Intronic
921837857 1:219796060-219796082 ATGTAAAAAAAGAGGAGAGATGG - Intronic
921928294 1:220731751-220731773 ATAAAGAAGAAGAGGATTGAGGG - Intergenic
924190863 1:241551384-241551406 ATGTACAAGAACAATCTAGAAGG + Intronic
1064569351 10:16676242-16676264 ATGAAGAAAAAGAGGCTTAATGG + Intronic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1068966373 10:62915966-62915988 ATGTAGATGAAGTGCATAGACGG + Intronic
1069282359 10:66670539-66670561 AGGTAGAAGGGGAGGTTAGAAGG - Intronic
1069571142 10:69495124-69495146 CTGTAAAACAAGAGGCTGGATGG + Intronic
1070827943 10:79401999-79402021 ATGTAGAAACAGAGGCCACAGGG + Intronic
1071218699 10:83437222-83437244 ATGTAAAAGAAGGGGACAGAGGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072101222 10:92231259-92231281 ATGTAGTGGAGGGGGCTAGAAGG - Intronic
1072705920 10:97680839-97680861 AGGCAGAAGAGGAGGCTACAAGG + Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1074237198 10:111597614-111597636 TTGTAGAAGATGGGGCTAAAAGG - Intergenic
1075151246 10:119934724-119934746 AGGTAGAAGATGAGGCTGAAGGG - Intronic
1075693393 10:124416629-124416651 ATGTAGATGGATGGGCTAGATGG - Intronic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076601691 10:131660834-131660856 ATGTGGAAGAAGAAGCTAAGGGG + Intergenic
1077212089 11:1375766-1375788 GTGTGGGAGAAGAGGCTTGAGGG - Intergenic
1077813082 11:5658342-5658364 AGGTGGATGAAGAGGCCAGAAGG - Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078548060 11:12260694-12260716 TTTTAGAAGAAGAGAGTAGAAGG + Intronic
1079181047 11:18193799-18193821 ATGAAGAAGAAGAGGAGAGAGGG + Intronic
1079598609 11:22284803-22284825 ACGTAGAAGAGGAGCCAAGATGG + Intergenic
1080108743 11:28541491-28541513 AAGTACAAGATGAGACTAGAGGG + Intergenic
1081196124 11:40162971-40162993 ATGTAGTAGAGGTGGTTAGAGGG - Intronic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1082821842 11:57549414-57549436 ATGTAGAACTAGAGACCAGAGGG + Intronic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1083945940 11:65922659-65922681 CTGCAGAGGAAGAGGCTACACGG + Intergenic
1085349233 11:75787941-75787963 ATGGAGAAGAAGAGGCCTGATGG - Intronic
1085724158 11:78940114-78940136 ATGTAAAAGAAAAGACTAGGAGG - Intronic
1086100448 11:83093912-83093934 ATGCAGAACGTGAGGCTAGATGG - Intergenic
1086374985 11:86190975-86190997 ATGTATAAGAAGCAGGTAGAAGG - Intergenic
1087906965 11:103709657-103709679 ATGTTGAAGCAGAGGCTGGGTGG - Intergenic
1088369592 11:109074689-109074711 AAATAGATGAAGATGCTAGAAGG - Intergenic
1089308372 11:117541535-117541557 ATGTGGCAGCAGTGGCTAGAGGG - Intronic
1089385379 11:118063974-118063996 ATGAAGAACAATTGGCTAGAAGG + Intergenic
1089531664 11:119133909-119133931 ATGTAGAAGAAAAGGCAAGAGGG - Intronic
1089704029 11:120264494-120264516 AGGTAGAAGAGGAGGAGAGAAGG + Intronic
1090067924 11:123519196-123519218 ACATAGATGAATAGGCTAGAAGG + Intergenic
1090587969 11:128234765-128234787 AAGAAGAGGAAGAGACTAGAAGG - Intergenic
1091529766 12:1342793-1342815 ATTTTGAGGAAAAGGCTAGAAGG + Intronic
1092253238 12:6913075-6913097 AGGTAGGGGAAGAGGCAAGAGGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1093228194 12:16511394-16511416 GTATTGAAGAGGAGGCTAGATGG - Intronic
1093509773 12:19912728-19912750 ATGAAAAAGATGAAGCTAGAGGG - Intergenic
1095885866 12:47187865-47187887 ATGTAGAGGAAGACCCCAGAAGG + Intronic
1096612432 12:52811626-52811648 ATGTAGCAAAACAGACTAGAGGG + Intronic
1097230722 12:57508693-57508715 AGGTAGAGGTAGAGGGTAGAGGG + Intronic
1097922308 12:65089570-65089592 ATGTGGGAGAAGAGGCTGGTGGG - Intronic
1098282034 12:68871553-68871575 ATGAAGATGGAGAGGCTAGGTGG + Intronic
1098606503 12:72397098-72397120 AGGTAGAAGAGTAGGCTTGACGG - Intronic
1099513134 12:83562899-83562921 ATGCATTAGAAGAGACTAGAAGG - Intergenic
1099886182 12:88534134-88534156 ATGAAGAAACTGAGGCTAGAAGG + Intronic
1099887039 12:88544308-88544330 ATGAAGAAACTGAGGCTAGAAGG + Intronic
1103712877 12:122926011-122926033 ATGTACATGAAAAGGCCAGAGGG + Intronic
1104008993 12:124915473-124915495 AGGTGGAAGAACAGTCTAGAAGG - Intronic
1105285064 13:18996707-18996729 ATGTAGAAGGCCAGGCCAGATGG + Intergenic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1106461090 13:29969791-29969813 GTGTAGGAGAAGAGGATATAAGG - Intergenic
1107619639 13:42213050-42213072 ATGTAGATGAAGAGGTGAGGAGG + Intronic
1108489969 13:50971677-50971699 ATGAAGAAGAAAGGGCTAGCCGG - Intronic
1109185575 13:59263789-59263811 GTGTAGAGGAAGACTCTAGAGGG + Intergenic
1110049041 13:70871926-70871948 ATGAAGAAAAAGAGGCTTAATGG + Intergenic
1110065197 13:71095673-71095695 TTGTAGAGGAAGAGGATAGATGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1112025257 13:95405743-95405765 ATTTGGAAAAAGAGGCTGGAAGG + Intergenic
1112142499 13:96660908-96660930 AGGTAGAAGAAGTGGGAAGAAGG + Intronic
1112158811 13:96847715-96847737 ATGTAGAAAAAGAAACTAAAAGG - Intergenic
1112714708 13:102170315-102170337 AGGGAGAAGAAGAGGCAAAAAGG - Intronic
1112767089 13:102756830-102756852 ATGGAGAAGAAGAGGTTAGGGGG - Intronic
1113201336 13:107868898-107868920 ATGCAGCAGAAGAGGCTAGTAGG - Intergenic
1113299983 13:109007608-109007630 AAGTAGAAGAGTAGCCTAGAGGG + Intronic
1113777669 13:112957746-112957768 AGGTGGAAGAAGAGACTACAAGG - Intronic
1114372006 14:22100102-22100124 ATGAAGCACAAGAGGCTAGAGGG + Intergenic
1115531180 14:34328647-34328669 AGGTAGAACAACAAGCTAGAAGG + Intronic
1116407715 14:44585544-44585566 ATGAAGAGGAAGAGGGTATATGG - Intergenic
1116504934 14:45666155-45666177 ATGTAGAAGGTGGGGCAAGATGG - Intergenic
1117243403 14:53859050-53859072 ATGTAGAGGAAGAGGAAAAAAGG - Intergenic
1117302469 14:54443043-54443065 GTGTAGAGGAAGAGGCGCGAGGG + Intergenic
1117474576 14:56080981-56081003 ATCTAGAAGGAGTGGCTACATGG + Intergenic
1117728858 14:58701292-58701314 ATGTACAAAAAGAGTCAAGACGG - Intergenic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1119112873 14:71991337-71991359 ATGTGGAAGATGAGGAGAGAGGG - Intronic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1124121501 15:26892750-26892772 ATGGAGAAGAAGAGGATCGTGGG + Intronic
1124232271 15:27955845-27955867 ATGAAAAAGAAGAGGCAAGTGGG - Intronic
1124613923 15:31228143-31228165 ATGAAAAAGAGGAAGCTAGAGGG + Intergenic
1124853538 15:33364442-33364464 ATGTAGAGGAAAGGGATAGATGG - Intronic
1125026927 15:35040112-35040134 ATATATATGAAAAGGCTAGAAGG + Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128760455 15:70213105-70213127 ATGTAAAAGAAGAGGTGGGAGGG + Intergenic
1129150811 15:73686739-73686761 TTGTAGAACAAGTGGCTGGATGG + Intronic
1129290970 15:74567310-74567332 AGGTAGAAGAAAAGGCTGGATGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132014466 15:98303501-98303523 ATGAAGAAAAAGAGGCTTAATGG + Intergenic
1132984115 16:2755015-2755037 ATGTAAAAGAACTGGATAGAAGG - Intronic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1135019916 16:18954888-18954910 ATGAGGAAGAAGGGGCTAGATGG + Intergenic
1137519178 16:49177518-49177540 TTGAAGAAGAAGTGGTTAGAAGG + Intergenic
1138130327 16:54473828-54473850 ATCTGGTAGAAGGGGCTAGATGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1139478743 16:67216542-67216564 CTGAAGAAGAGCAGGCTAGAAGG - Intronic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1141231946 16:82176057-82176079 AGCTAGAAGATAAGGCTAGAAGG - Intergenic
1142286640 16:89174137-89174159 ATGTGGAAGAAGAGGCATGGAGG - Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143431508 17:6890834-6890856 ATGGAGAAGAAGGGGCTATTTGG + Intronic
1145890309 17:28409740-28409762 ATGTAGAATTAGAGGCTTCAAGG - Intergenic
1148810150 17:50285193-50285215 AAGTAGGAGAAGACGCTTGAGGG - Intergenic
1149370803 17:55992061-55992083 ATAAAGAAAAAGAGGCTTGATGG + Intergenic
1150861945 17:68809642-68809664 ATGAAGAAGAGGAGGATAAAAGG + Intergenic
1152152964 17:78614403-78614425 ATAAAGAAAAAGAGGCTTGATGG - Intergenic
1152533792 17:80938374-80938396 AATTAGAGGAAGAGTCTAGAAGG - Intronic
1203180159 17_KI270729v1_random:50432-50454 ATGTAGTAGAATAGAATAGATGG + Intergenic
1154303693 18:13216364-13216386 ATGACGAAGTTGAGGCTAGAAGG - Intergenic
1158109432 18:53924208-53924230 TTGCAGAATAAGAGGCAAGAAGG + Intergenic
1158127885 18:54122112-54122134 ATAGAGAAGAAGAGGTTTGATGG + Intergenic
1158500113 18:57993425-57993447 ATTTTGGAGAAGTGGCTAGAGGG + Intergenic
1158605304 18:58890736-58890758 AGGAGGAAGAAGAAGCTAGAGGG - Intronic
1159002639 18:62987646-62987668 AGGCAGAAGAAGAGGGCAGAGGG - Intergenic
1159066489 18:63573741-63573763 ATGTAGAATAAAAGGATAAAGGG + Intergenic
1159375921 18:67592856-67592878 ATGCAGAAGAAGAATATAGAAGG - Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1161291966 19:3498991-3499013 ATGTAGATGGAGAGCTTAGAGGG + Intronic
1162194749 19:8975870-8975892 TTGTAGGAGATGAGGTTAGAGGG + Exonic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1164599576 19:29551892-29551914 ATGTAAAAAAAGAGGCTACAGGG + Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1167714945 19:51137227-51137249 ATGTCCAAGAAGAGGCTCAAGGG - Intergenic
1168517254 19:57018061-57018083 ATGTAGAAGAGGAGATGAGATGG - Intergenic
925098242 2:1224451-1224473 ATGCAGCAGAGGAGGCGAGAGGG - Intronic
925299624 2:2801352-2801374 ATGAAGAAAAAGAGGTTTGATGG - Intergenic
926222480 2:10945259-10945281 ATGTAGATGAAGGGGGTTGATGG - Intergenic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928574638 2:32642561-32642583 TTTTAAAAGAAGAGGTTAGAAGG + Intronic
928615911 2:33039446-33039468 ATGTAGTATAAGAGGTAAGAAGG - Intronic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929424351 2:41828871-41828893 ATGCAGAGGAAGAGGGGAGATGG + Intergenic
929981856 2:46688789-46688811 ATATACAAGATGAGGATAGAAGG - Intergenic
930115367 2:47713473-47713495 TGTTAGAAGAGGAGGCTAGAGGG - Intronic
930395876 2:50824156-50824178 AAGTAGAATAAGAGGCTGAATGG + Intronic
930449047 2:51511051-51511073 ATGTTGGAAAAGAGGCTACATGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930775355 2:55165350-55165372 ATGAAGAAGACGAGGAAAGAGGG + Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
931423850 2:62152773-62152795 ATGTAGAAAAATAGGCCAGTAGG + Intergenic
931639800 2:64371780-64371802 ATGTTGAAGGAGAGGCCAAAAGG + Intergenic
932346054 2:70995650-70995672 ATGTAGAACAAGAGTCTAGTAGG + Intergenic
932742142 2:74299507-74299529 ATAAAGAAAAAGAGGCTTGATGG - Intronic
933010689 2:77058465-77058487 AAAAAGAAAAAGAGGCTAGAAGG - Intronic
933936422 2:87207518-87207540 ATGCAGACTAAGAGGCAAGATGG - Intergenic
935489542 2:103699363-103699385 AGGCAGAAGAAGAGGCAAAAAGG + Intergenic
936356727 2:111758311-111758333 ATGCAGACTAAGAGGCAAGATGG + Intergenic
936643337 2:114341266-114341288 ATGTAACAGAAGCTGCTAGATGG + Intergenic
936756933 2:115725480-115725502 ATGTAGAAGAACAAGCAATATGG - Intronic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
937050189 2:118882268-118882290 ATGTCGAAGAAGAGGCTCTGTGG - Intergenic
938421154 2:131147907-131147929 AAGTAGAAAAATAGGCTATAAGG - Intronic
939770823 2:146315339-146315361 ATTTAGGAAAAGAGGCTAAATGG - Intergenic
939798580 2:146678970-146678992 ATGTCGGAGAAGCGGCTTGAGGG - Intergenic
939978639 2:148751333-148751355 ATCTAGAAGAAAAGCCTATATGG + Intronic
940057318 2:149526566-149526588 AGGTACAGGAAGAAGCTAGAAGG + Intergenic
940793326 2:158051348-158051370 TGGAAAAAGAAGAGGCTAGAGGG + Intronic
941167728 2:162101366-162101388 AGGTAGAAGAAAAGGCAGGAAGG + Intergenic
941801254 2:169662403-169662425 ATGAGGAAGAAGAGGAAAGAAGG - Exonic
943341028 2:186682454-186682476 ATGTCAAAGAAGAGACCAGATGG - Intergenic
943992448 2:194713934-194713956 ATGTAGAAGAGGAGACCAGGTGG - Intergenic
944538059 2:200730803-200730825 AGGTAAAAGTGGAGGCTAGAGGG - Intergenic
945907991 2:215615572-215615594 ATGCAGCAGAAGAGGATGGAAGG - Intergenic
946162376 2:217843371-217843393 ATGTAGAAGAGGAGGGGAGTAGG - Intronic
946497353 2:220208004-220208026 ATGTAGAAGAGCAGGTTACAAGG - Intergenic
947067499 2:226245226-226245248 ATGTAGAAAAAGAGGAAAAAAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947242264 2:228008259-228008281 ATGTAGGAGAAAAATCTAGATGG - Intronic
949007133 2:241656096-241656118 ATGCAGAAGGAGAGGCTTCAAGG - Intronic
1169989998 20:11491757-11491779 ATGTACAAGTTGAGGCTAGCTGG - Intergenic
1170223565 20:13966284-13966306 AAGAAGAAGAAGAGGCAAGAAGG - Intronic
1171161077 20:22924399-22924421 TTGTTGAAGAAGAGGATAAAAGG + Intergenic
1171331533 20:24343464-24343486 ATAAAGAAGAAGAGGAAAGAAGG - Intergenic
1172197997 20:33105221-33105243 ATGGAGAAAAAGAGTTTAGAAGG - Intronic
1172262809 20:33583005-33583027 ATGTATAAGAAAAAACTAGAAGG - Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1173544815 20:43887389-43887411 ATCTATAAGAAGAGGCATGAGGG - Intergenic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174777085 20:53353493-53353515 ATGTAGAAGAAAATGCTTAATGG - Intronic
1175630214 20:60529277-60529299 AAGTAGAAGAGGAGACCAGAAGG + Intergenic
1175734125 20:61373377-61373399 ATGCAGAACAAGTGGCTAAAGGG - Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178918157 21:36720931-36720953 ATGCAAAAGAAGAGGCTTTAAGG + Intronic
1179137541 21:38693413-38693435 ATGGAGATGAAGAGGATGGATGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181449305 22:23007553-23007575 ATTTAGAAGAAGAGGGCATATGG + Intergenic
1181982468 22:26775073-26775095 ATGGAGAAGACAAGGCAAGATGG - Intergenic
1182035752 22:27197021-27197043 ATGGGGAAAAAGAGTCTAGAAGG + Intergenic
1182078876 22:27514976-27514998 ATGTTGAAGAAGATGCTAACTGG - Intergenic
1182565553 22:31195849-31195871 ATGTAGCAGGAGAGGCTCCAGGG + Intronic
1182830335 22:33299878-33299900 AAGTAGATGAAGGGGCTGGAAGG + Intronic
1184277245 22:43416485-43416507 AGGGAGGGGAAGAGGCTAGAGGG - Intronic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
950096493 3:10333733-10333755 ATGAAGAGGGAGAGGCAAGATGG + Intronic
951444748 3:22765484-22765506 ATGTGGAGGAAGAGGCCACATGG + Intergenic
952504906 3:33998856-33998878 TTGTAGAAGAAGAGGAGTGAGGG + Intergenic
952525077 3:34201416-34201438 AGGAAGAGGAAGAAGCTAGAGGG + Intergenic
952578912 3:34807714-34807736 ATGAAAAAGAAGAGGTTAGGAGG + Intergenic
953616638 3:44496670-44496692 AGGTGGAGGAGGAGGCTAGAGGG - Intergenic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
955607670 3:60723082-60723104 CTGAGGAAGAAGAGTCTAGAGGG - Intronic
956258154 3:67306563-67306585 ATGTGGTAGAAGAGGGTATAAGG + Intergenic
956374735 3:68602365-68602387 ATGTTGAAGATGAGACTTGATGG - Intergenic
956576839 3:70761217-70761239 ATGTGGGAGTAGAGGCTAGTAGG + Intergenic
956682138 3:71790714-71790736 ATGTAATAGAATATGCTAGAAGG - Intergenic
956790665 3:72677601-72677623 ATGGAGAAGAAGAGGCCAGCGGG - Intergenic
957530790 3:81438681-81438703 TTGTAGTAGAAGAGGATAAAAGG - Intergenic
958449547 3:94256985-94257007 ATGAAAATGAAGAGGCCAGAAGG + Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
961212465 3:125136341-125136363 ATGTGGGAGAAGAGTCTGGAAGG - Intronic
961579334 3:127866185-127866207 AGGTCGTAGAAGAGGCCAGAAGG - Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967404042 3:189096519-189096541 CTGTAGAAGAACAGGTCAGAAGG - Intronic
967613496 3:191536722-191536744 ATATAGGTAAAGAGGCTAGAAGG + Intergenic
970173636 4:13314482-13314504 ACTTTAAAGAAGAGGCTAGAGGG - Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971971184 4:33622903-33622925 AGGAGGAAGAAGAAGCTAGAGGG + Intergenic
972028055 4:34412135-34412157 AAAAAGAAGAAGAGGCAAGATGG - Intergenic
972229990 4:37061264-37061286 ATGTAGTAGAAGAGGCTGCATGG - Intergenic
973539367 4:51921057-51921079 ATGAGGAAGAGAAGGCTAGAGGG - Intergenic
974116679 4:57587572-57587594 ATGGAGAACAAGAGGAGAGAAGG + Intergenic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
975370104 4:73575352-73575374 ATGTAGAATAAGATGCTAAGAGG + Exonic
975525842 4:75350072-75350094 ATGAAGAAAAAGAGGCTTAAAGG - Intergenic
976881483 4:89931575-89931597 ATATAGAAAAAGAGGTTTGATGG + Intronic
976893147 4:90075309-90075331 AGGTAGCAGAAGAGGCAATAGGG + Intergenic
977380128 4:96262359-96262381 AAGTAGAGGAAGAGGTTAGGGGG - Intergenic
979070124 4:116192372-116192394 ATGAAGAAAAAGAGGATAGCTGG + Intergenic
979320343 4:119315958-119315980 GTGTAGAAAAAGAGACTAAAGGG + Intergenic
979453077 4:120895556-120895578 ATGAAGAAGATGAGGGCAGAGGG - Intronic
979478911 4:121191165-121191187 ATGAAGAAGCAGAGACTATAAGG + Intronic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
981398033 4:144277572-144277594 ATTTAGAAGAAGAGATTAGATGG - Intergenic
982777153 4:159453568-159453590 AGGTTGAAGAAGAGGCAGGAAGG - Intergenic
982903950 4:161044289-161044311 GTGGAGAGGAAGAGGATAGATGG + Intergenic
983896564 4:173087189-173087211 AGGAAGCAGAAGAGGGTAGATGG - Intergenic
984931638 4:184852893-184852915 ATGCAGAGGAAGAGGTAAGATGG - Intergenic
986243161 5:5979697-5979719 AGGTGTAAGAAGTGGCTAGAGGG - Intergenic
986884352 5:12215541-12215563 ATGTACACTAAGAGGCAAGATGG - Intergenic
986903020 5:12460336-12460358 ATGTATAAGAAGGGGTTTGAAGG + Intergenic
987588291 5:19888146-19888168 TTGAAGAAGAAAAGGGTAGAGGG - Intronic
988463738 5:31467200-31467222 ATATATTAGAAGAGGCTAAAGGG - Intronic
988604513 5:32668126-32668148 ATGAAGCAGAAGGGCCTAGAAGG + Intergenic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
990597924 5:57329868-57329890 ATGAAGATGAAGAGGCAAAAAGG - Intergenic
991033273 5:62103842-62103864 ATGTAGAAGAAGAGACCCAAAGG + Intergenic
991556817 5:67904267-67904289 ATATAGCAGAAGAGGCTTCATGG + Intergenic
992288108 5:75256122-75256144 ATGTCGAAGAAGAGCCAAGATGG - Intergenic
993335793 5:86657060-86657082 AGGAAGAAAAAGAGGCCAGAGGG - Intergenic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
995977371 5:118056079-118056101 ATGTAGAGTAAGTTGCTAGAGGG - Intergenic
996696538 5:126402945-126402967 ATGTAGAATGTGAGGCTAAAAGG + Intronic
997592958 5:135086794-135086816 GTGTGGAAGAAGGGTCTAGAAGG + Intronic
998554575 5:143110600-143110622 ATCTAGAAAAAGATGCCAGAGGG - Intronic
1000120636 5:158194662-158194684 ACGTAGCAGAAGGGGCTGGAGGG - Intergenic
1000248136 5:159467284-159467306 GAGTATACGAAGAGGCTAGAAGG - Intergenic
1002005462 5:176229900-176229922 ATGTATAAGAAGAGCATAAAGGG + Intergenic
1002220912 5:177680718-177680740 ATGTATAAGAAGAGCATAAAGGG - Intergenic
1002873973 6:1194310-1194332 ATGTAGAAGAAAGGTGTAGAAGG - Intergenic
1003037752 6:2659855-2659877 ATGGAGAAGAAGGAGCCAGACGG + Intergenic
1003369579 6:5511064-5511086 AGGGAGAAGGAGAGGCCAGATGG + Intronic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004865400 6:19848320-19848342 ATGTAGAAAAAGAGGCTAAATGG + Intergenic
1006039046 6:31238624-31238646 GTGTAGACAAAGAGTCTAGAGGG + Intergenic
1006607362 6:35267792-35267814 ATGTCAAAGATGAGGCAAGATGG + Intronic
1006790002 6:36693653-36693675 ATCTGGAAGAAGAGGTTCGAGGG - Intergenic
1007126390 6:39429288-39429310 AGGTAGAATAAGAGACTTGAGGG - Intronic
1007622389 6:43222993-43223015 ATGAAGAGGAAGAGGAGAGAGGG - Intronic
1008056307 6:46949474-46949496 ATGTAGCAGAAAAGGAAAGATGG + Intronic
1008495333 6:52127180-52127202 ATGTAGAAGAATAGGATGGCAGG + Intergenic
1008557936 6:52693464-52693486 ATGTGGAAGAAGAGGTAATAAGG + Intergenic
1011354627 6:86461430-86461452 AAGAAGAAGAAGAGGATAGAAGG + Intergenic
1011409270 6:87049782-87049804 ATGGAGAAAAAGTGGCTAGTGGG + Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1011960230 6:93079480-93079502 ATGTAGAACAACAAGCTAAACGG + Intergenic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013768528 6:113600648-113600670 ATGTTGGAGAAGAGGCCTGATGG + Intergenic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1015592617 6:134836984-134837006 ATGTGGAAGAAGAGGAGTGAAGG - Intergenic
1016422097 6:143896142-143896164 CTGTAGAAGAAGAGGCACTAGGG - Intronic
1016901328 6:149105841-149105863 ATGTAAGAGAAGATGATAGATGG - Intergenic
1017330415 6:153191846-153191868 ATGTTGGAGAAGGGGCTAGGTGG - Intergenic
1017470480 6:154733549-154733571 GTGTAGGGGAAGGGGCTAGAGGG + Intronic
1017472639 6:154754731-154754753 AAGTAGAAGAAGAGCCTACAAGG - Intronic
1018049089 6:159992144-159992166 AACTAGAAGAAGATGCTAGGTGG + Intronic
1018208907 6:161461328-161461350 AGGTGGAAGATGAGGCCAGAGGG + Intronic
1018675144 6:166214323-166214345 AGGAAGAAGAAGAGGAAAGAAGG + Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1021910747 7:25383997-25384019 ATGGAGAAGAAGAGACTATTGGG - Intergenic
1021929792 7:25568890-25568912 AAGTAGAAGAAAAGGCAGGAAGG - Intergenic
1022108726 7:27214656-27214678 AAGGAGAGGAAGAGGCTAGTAGG + Intergenic
1022461155 7:30608525-30608547 CTGTAGAAATAGAGTCTAGAAGG + Intronic
1023637189 7:42224264-42224286 ATGTAGAAAAATAAGCAAGATGG - Intronic
1023708597 7:42968124-42968146 ATGAAGAAAAAGAGGTTTGATGG - Intergenic
1024154313 7:46604727-46604749 TTCTAGAAGAATATGCTAGAAGG + Intergenic
1024404601 7:48963612-48963634 AAGTGGAAAAAGAGGCTGGAGGG - Intergenic
1024924765 7:54601098-54601120 ATCCAGTAGAAAAGGCTAGATGG + Intergenic
1024935106 7:54703674-54703696 TTCCAGAAGAAGAGACTAGAAGG - Intergenic
1026212629 7:68319270-68319292 ATGTAGAAAAACAGGCTGCAGGG + Intergenic
1027161175 7:75803511-75803533 ATGCAGAAGAAGAGGGTAGCAGG - Intergenic
1027812710 7:82925629-82925651 GGGTAGAAGCAGAGGATAGAGGG - Intronic
1028118405 7:87028353-87028375 GTGTTGAAGAAGAGGGTTGATGG - Intronic
1028366298 7:90036593-90036615 ATGTAGATGACGAGGGTTGATGG + Intergenic
1028663361 7:93310619-93310641 ATGTAGAAGAAGTGAACAGAGGG - Intronic
1029116293 7:98239170-98239192 ATGTATAAGAAGAGCCCTGATGG - Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1031729919 7:125287455-125287477 ATGTAGAAGGACATGTTAGAGGG - Intergenic
1031906954 7:127471042-127471064 ATGTAGAAGAGGAGTTCAGAAGG - Intergenic
1031925392 7:127633787-127633809 ATGAAGAAAAAGAGGCTTAATGG + Intergenic
1032020102 7:128402914-128402936 ATGTACAAGAACTGGCAAGAGGG - Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1033724600 7:144101043-144101065 CTGTAGATGAACAGGCTTGAAGG - Intergenic
1035207393 7:157302768-157302790 AAGAAGAAGAAGAAGATAGAGGG - Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037227872 8:16616513-16616535 ATGGAAAGGAAGAGGCTATAAGG + Intergenic
1038007438 8:23444729-23444751 CTGCAGAAGAAGTTGCTAGAAGG - Intronic
1039196502 8:35037751-35037773 ATGTAGGAGAAAAATCTAGATGG + Intergenic
1039317330 8:36387888-36387910 AGGAAGAAGAAGAGGAAAGAAGG - Intergenic
1040669285 8:49669198-49669220 AGGAGGAAGGAGAGGCTAGAAGG + Intergenic
1040747527 8:50663392-50663414 ATGGAGATGAAGGGGCCAGAGGG + Intronic
1041497768 8:58505955-58505977 ATGAGGAAGTAGAGGCAAGAAGG + Intergenic
1043779987 8:84321088-84321110 AGAAAGAAGAAGAGACTAGATGG + Intronic
1043813584 8:84773764-84773786 ATATAGAAAAGGAAGCTAGAAGG - Intronic
1044076859 8:87832369-87832391 TCTTAGAAGAAGATGCTAGAGGG - Intergenic
1044114684 8:88320758-88320780 GTATATAAAAAGAGGCTAGAGGG - Intronic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1046338337 8:112820055-112820077 AAGTAGCAGATGAGGCTAGAGGG - Intronic
1046962300 8:120124639-120124661 AGGGAGAAGAGGAGGCTCGAAGG + Intronic
1048008638 8:130439100-130439122 AGGTGGAAGAAGATGCCAGAAGG + Intronic
1049291366 8:141804309-141804331 AACAAGAGGAAGAGGCTAGAAGG - Intergenic
1049716941 8:144097431-144097453 ATCTGGAAGAAGAGGCAAGGGGG + Exonic
1050133995 9:2442231-2442253 AAGTAGAAGCAGTGCCTAGAAGG - Intergenic
1050577560 9:7013801-7013823 ATGAAGAAAATGATGCTAGATGG + Exonic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1055269741 9:74544567-74544589 AGGGAGAAGAATAGGCAAGAAGG - Intronic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1056739708 9:89243857-89243879 ATGTACAATAAGAGGCAAAATGG - Intergenic
1056944912 9:90986056-90986078 ATATAAAAGTAGAAGCTAGAAGG + Intergenic
1058171262 9:101683959-101683981 CTGTAGAAGAAATGGATAGATGG - Intronic
1058757512 9:108096931-108096953 ATCTACTAGAAGAGGCCAGATGG - Intergenic
1058858980 9:109095886-109095908 CTGGAGAAAAAGAGACTAGAGGG + Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1060069502 9:120533916-120533938 ATGGAGGAGAACAGGCTAGAAGG - Intronic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1062525415 9:136976295-136976317 ATGTAGCAGCAGGGGCTAGTGGG - Intergenic
1186262200 X:7791554-7791576 ATAAAGAAAAAGAGGCTAAATGG + Intergenic
1186570713 X:10712344-10712366 ATGTACAATAAGAGGCAAAATGG + Intronic
1186705666 X:12137703-12137725 ATGTAAAAGAGAAGGCTAGGAGG + Intergenic
1186720598 X:12299828-12299850 CAGGAGAAGAAGAGGATAGAAGG + Intronic
1186976841 X:14916923-14916945 ATGTAGAAAAGGAGAATAGAAGG + Intronic
1187205040 X:17174111-17174133 TTATAGAAGATGAGGCCAGAAGG + Intergenic
1187455404 X:19437000-19437022 CTGTAGAAGAACAGGTTTGATGG - Intronic
1187725556 X:22198726-22198748 ATGTCAAAGAACAGGCCAGAGGG + Intronic
1187880689 X:23844490-23844512 AGGCAGAAGAAGAGGTCAGAAGG + Intronic
1188008878 X:25037860-25037882 ATGGTGAAGAAGAGCCTAAAGGG + Intergenic
1188740899 X:33780075-33780097 AAGTAGCAGTAGAGGATAGAAGG + Intergenic
1189333176 X:40155285-40155307 CTTTAGAAAAAGAGGCGAGAAGG + Intronic
1191843862 X:65532038-65532060 AGGGAGAAGGACAGGCTAGAGGG - Intronic
1192037994 X:67586669-67586691 TTTTAGAAGATGAGGTTAGACGG + Intronic
1195520385 X:105822566-105822588 CTGGAGACGAAGAAGCTAGAAGG - Exonic
1196392388 X:115221836-115221858 ATGTAGAAGATGAGGGGAAAGGG + Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1197884891 X:131208366-131208388 ATGTAGAGGAACAGTCCAGACGG + Intergenic
1198651845 X:138871824-138871846 AGGTAGGAGATGAGGCCAGAAGG + Intronic
1198714083 X:139537801-139537823 AAGTAGCAGAGGAGGCAAGAAGG - Intronic
1199372134 X:147062237-147062259 TTATAGAAGTAGAGGGTAGAGGG + Intergenic
1201708377 Y:16961858-16961880 ATGTAGATGATGAGGGTTGATGG + Intergenic
1201797365 Y:17912045-17912067 ATCTAGAAGAAAAGGCCAGTAGG + Intergenic
1201804188 Y:17993940-17993962 ATCTAGAAGAAAAGGCCAGTAGG - Intergenic
1202358735 Y:24081071-24081093 ATCTAGAAGAAAAGGCCAGTAGG + Intergenic
1202512043 Y:25589042-25589064 ATCTAGAAGAAAAGGCCAGTAGG - Intergenic