ID: 975276744 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:72511108-72511130 |
| Sequence | TTTGATTTGATTTTTGCATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 975276744_975276745 | 28 | Left | 975276744 | 4:72511108-72511130 | CCATATGCAAAAATCAAATCAAA | No data | ||
| Right | 975276745 | 4:72511159-72511181 | CAAATTATGAAACTATTACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 975276744 | Original CRISPR | TTTGATTTGATTTTTGCATA TGG (reversed) | Intronic | ||