ID: 975276744

View in Genome Browser
Species Human (GRCh38)
Location 4:72511108-72511130
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975276744_975276745 28 Left 975276744 4:72511108-72511130 CCATATGCAAAAATCAAATCAAA No data
Right 975276745 4:72511159-72511181 CAAATTATGAAACTATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975276744 Original CRISPR TTTGATTTGATTTTTGCATA TGG (reversed) Intronic