ID: 975280389

View in Genome Browser
Species Human (GRCh38)
Location 4:72555468-72555490
Sequence CTGTGGATAAGTTGCCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975280389_975280390 -7 Left 975280389 4:72555468-72555490 CCTTCTTGGCAACTTATCCACAG 0: 1
1: 0
2: 2
3: 12
4: 134
Right 975280390 4:72555484-72555506 TCCACAGAGTACAGACCTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 176
975280389_975280395 23 Left 975280389 4:72555468-72555490 CCTTCTTGGCAACTTATCCACAG 0: 1
1: 0
2: 2
3: 12
4: 134
Right 975280395 4:72555514-72555536 TTCCATAGCACTCCCTGTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975280389 Original CRISPR CTGTGGATAAGTTGCCAAGA AGG (reversed) Intronic
901184174 1:7361585-7361607 CTGTGGAAAAGTTGCTCAGGTGG - Intronic
904801542 1:33096538-33096560 CTGTGGACAGCTGGCCAAGAAGG - Intronic
906797866 1:48711920-48711942 CTGTGGAAAGGTTTCCAGGAAGG - Intronic
907730701 1:57062673-57062695 CTGAGGAAAAGTTGCCAATCTGG - Intronic
908418422 1:63935561-63935583 CTGTGGGTAGTTTACCAAGAAGG + Intronic
910770647 1:90827844-90827866 CTGGGAACAACTTGCCAAGAGGG + Intergenic
1062805076 10:413195-413217 CTGTGGATAAGAGGCCATGGAGG - Intronic
1063545240 10:6974720-6974742 CAGTGAATAAGTTGCCATGAAGG - Intergenic
1066273517 10:33846356-33846378 CAGTGGACCAGTTGCCATGAGGG + Intergenic
1067106917 10:43372767-43372789 CAGTTGGTAAGTTGCTAAGAAGG + Intronic
1067114597 10:43425450-43425472 CTTTGGAAAAGTTGCCTAAATGG - Intergenic
1068794743 10:61067199-61067221 ATTTGGAAATGTTGCCAAGAGGG + Intergenic
1073721555 10:106178501-106178523 GTGTGGATAATTTCCAAAGATGG - Intergenic
1074678088 10:115875417-115875439 CTGTGGATAAGTTATCCTGAGGG + Intronic
1078820777 11:14879138-14879160 CAGTGGATATTTTGCCAAGAAGG - Exonic
1079916502 11:26374660-26374682 CTGTGGAAAAATTGTCAACAAGG - Intronic
1080244648 11:30166013-30166035 CTGTGGTTAAATTGGCAAGTAGG + Intergenic
1081321721 11:41699872-41699894 CTATGAATAATTTGGCAAGAAGG + Intergenic
1081463323 11:43291691-43291713 TTCTGGAGAAGATGCCAAGATGG - Intergenic
1084685809 11:70694540-70694562 CTGTGGATAATTGGCCCACAGGG + Intronic
1087467039 11:98521785-98521807 CTGTGGATGAACTGACAAGAGGG + Intergenic
1088885373 11:114001738-114001760 CTGAGAATCAGATGCCAAGACGG - Intergenic
1092287798 12:7139485-7139507 CTGGAGATAAGTTGCAGAGATGG + Intronic
1093515151 12:19976979-19977001 CTGTGGATAAGTGTCAAAGAAGG + Intergenic
1094307676 12:29038951-29038973 CTGTAGAGAAGTGGCTAAGATGG - Intergenic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1101700639 12:107170454-107170476 CTGTGGCTAACTTTTCAAGAAGG + Intergenic
1102321344 12:111937626-111937648 CTTTGGAAAAGCTCCCAAGAAGG - Intronic
1105287452 13:19017059-19017081 CTGAGGACATGTTCCCAAGATGG - Intergenic
1112809644 13:103203195-103203217 GTGTTTATAAGTTGCCAAGCGGG - Intergenic
1121425662 14:93849836-93849858 CTGAGGATATGTTTCCAAGATGG + Intergenic
1124420539 15:29517385-29517407 CTGAGGTCAAGTGGCCAAGATGG + Intronic
1124686629 15:31788590-31788612 CTATGGATGATTGGCCAAGATGG - Intronic
1125547111 15:40513877-40513899 CTGTGGATGTGTGCCCAAGAAGG + Intergenic
1135476747 16:22783442-22783464 TTGTGGATAAGTTGCCTTGGAGG + Intergenic
1135638163 16:24096740-24096762 CTGTGAAACAGTTGCCAAGGGGG - Intronic
1137823043 16:51463852-51463874 CTGTGTATCAGTTTGCAAGATGG - Intergenic
1138582425 16:57950377-57950399 CTGTGGAGAAGATGCCCAGGTGG - Exonic
1139801616 16:69527455-69527477 CAGTGGATAAGTGGCAGAGATGG - Intergenic
1141886062 16:86893097-86893119 TTGTGGATAACATGCCAAGTGGG + Intergenic
1142501100 17:333698-333720 CTTAGGATAAGTTCCCAAAAGGG + Intronic
1149347838 17:55756168-55756190 CTGGGGATAAGTGGTGAAGAAGG + Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1152897201 17:82919288-82919310 CTGGGGATTACATGCCAAGAGGG - Intronic
1154052306 18:10972482-10972504 CGGTGGAGAGGTTGCTAAGAAGG + Intronic
1156601134 18:38608489-38608511 CTGTAGATATTTTGCCAAAAAGG - Intergenic
1156663861 18:39381913-39381935 ATGTGGATAATTAGACAAGAGGG + Intergenic
1156727715 18:40149073-40149095 CTGTGGAAAAGATGCCATGCAGG - Intergenic
1157959235 18:52133990-52134012 CTATGGATAATTTGCCAGGCAGG + Intergenic
1157992948 18:52519522-52519544 ATCTGGATAAGTTGCAATGAGGG + Intronic
1158773018 18:60544315-60544337 CTGATGATCAGTTGCCAGGATGG + Intergenic
1160076326 18:75680930-75680952 CTCTGCATAAGTCGCCAAGGAGG - Intergenic
1162321450 19:9973287-9973309 CTGAGGATGAGTTGCCCAGATGG - Intronic
1165673837 19:37704327-37704349 ATGTGGAATATTTGCCAAGAGGG + Intronic
1165966053 19:39581814-39581836 CTGTGCATAATTTCCCAAGAAGG - Intergenic
925796845 2:7554825-7554847 CAGTGGAGAAGCTGCCAAGAGGG + Intergenic
926813115 2:16773990-16774012 ATATGGATAACTTGCCAAGGGGG + Intergenic
928310758 2:30207631-30207653 CTGAGCATGAGTGGCCAAGAGGG + Intergenic
930302118 2:49629545-49629567 CTGCGTATAAGTTGCCAGAAGGG - Intergenic
933892126 2:86781619-86781641 CAGTGAATAAGTTGCCAGGTGGG - Intergenic
935049899 2:99516446-99516468 CTGTGGATATCTGACCAAGATGG - Intergenic
937503124 2:122505095-122505117 CTGTGGAAAAGTTTCTGAGAAGG - Intergenic
939298164 2:140297058-140297080 GTGTTCATAAGTAGCCAAGAGGG + Intronic
940165630 2:150767494-150767516 CTGGGTAAAAGTTGCCAAGGTGG - Intergenic
940453553 2:153870939-153870961 CAGTGAATAAATTGCCAAGCAGG + Intergenic
942493438 2:176512790-176512812 CTGTAGGTAAGTTGCAAAGCTGG - Intergenic
944496840 2:200315718-200315740 CTGTGGATGAGTTGGCCTGAAGG + Intronic
948687636 2:239679037-239679059 CTGTGGACAAGCTGCCCAGACGG + Intergenic
1173990670 20:47300657-47300679 ATGTGCAAGAGTTGCCAAGAAGG + Intronic
1175830671 20:61963868-61963890 CTGTGAAGAAATAGCCAAGATGG + Intronic
1177693848 21:24546089-24546111 TTCTGGTTAAGTTGCCAAGAGGG - Intergenic
1178341958 21:31793311-31793333 CTGTGGATAAGATGCTTACATGG + Intergenic
1179044084 21:37829613-37829635 CTGTGTCTGAGTTGCCAAGCTGG + Intronic
1180120598 21:45745067-45745089 CAGTGGAGAAGGTGCCCAGAGGG + Intronic
1181373532 22:22437818-22437840 CTGGGGCTAAGTTCCCCAGAAGG - Intergenic
1183985150 22:41565693-41565715 CTGTGGTTCATCTGCCAAGAAGG + Intronic
1185104650 22:48860458-48860480 GTGTGGAGAAGCTGCCCAGAGGG - Intergenic
950021820 3:9792832-9792854 CTGTGGCAAAGGTGACAAGAAGG + Intronic
950515162 3:13460356-13460378 CTGTGGACATTTTGCCAAAAAGG - Intergenic
951489577 3:23254712-23254734 CTGGGGAGGAGTAGCCAAGAAGG + Intronic
951773873 3:26287128-26287150 CTGAGGATATGTGTCCAAGAGGG - Intergenic
954028449 3:47801700-47801722 CTGTGTATCAGTTGCTAAGCTGG - Intergenic
959297486 3:104555501-104555523 CTGTGGATTAGTTGCCAAGCAGG - Intergenic
960173980 3:114495902-114495924 CTTTTTATAAGTTGCCAAGGTGG + Intronic
962528097 3:136253970-136253992 CTGTATATATGTTGCCAAGTTGG + Intronic
963713776 3:148779516-148779538 CTGTGGGTAATTTTTCAAGAGGG - Intergenic
964721281 3:159769259-159769281 CTGTGGACCTGTTGCCAAGTGGG + Intronic
965540653 3:169868120-169868142 CTGTGGAAAAGATGCCAATCTGG + Intronic
967845678 3:194040847-194040869 ATGTGGAGAAGCAGCCAAGAGGG + Intergenic
969579197 4:8054247-8054269 CTGTTGACAAATTCCCAAGAGGG + Intronic
971139484 4:23908533-23908555 CTCTGGATAATTTTCCAAGTAGG - Intergenic
971227393 4:24767482-24767504 CTGTGAATAAGTTGCCTTAAAGG + Intergenic
975280389 4:72555468-72555490 CTGTGGATAAGTTGCCAAGAAGG - Intronic
975978344 4:80125721-80125743 CTGAGGATAATTTGCCTTGAAGG + Intergenic
976467352 4:85386150-85386172 CTCTAGATAAATTGCTAAGATGG + Intergenic
977178632 4:93845731-93845753 CTGTGGATAACTGGTCATGAGGG + Intergenic
978281632 4:107023126-107023148 CTATGGAAAAATTGCAAAGAGGG - Intronic
982297983 4:153849558-153849580 CTCTGGAAAAGTTGCAAATAGGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983854094 4:172620097-172620119 CTAAAGAAAAGTTGCCAAGATGG + Intronic
984764994 4:183393724-183393746 CAGTGGACAAGTTGTTAAGAGGG + Intergenic
990195534 5:53310961-53310983 CTGAGGATTACTTGCCAGGAAGG - Intergenic
990805458 5:59655669-59655691 CTGTTGATAAGTGGAAAAGAGGG + Intronic
993404584 5:87495258-87495280 CTTTTGAGATGTTGCCAAGAAGG - Intergenic
996428412 5:123341323-123341345 CTGTGACTAATTTGCAAAGAAGG - Intergenic
996582750 5:125049454-125049476 TTGTGGAAAAGTTGCTTAGATGG + Intergenic
1002129898 5:177074335-177074357 CAGTTGAGAAGTTGCCAAGTGGG + Intronic
1002880527 6:1246963-1246985 CTGTGGATGATCTGCCAAGCAGG + Intergenic
1003794452 6:9584487-9584509 GTGTAGATAAATGGCCAAGATGG + Intergenic
1006173259 6:32107590-32107612 CTGTGGGGAGGGTGCCAAGAGGG - Intronic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007387249 6:41528287-41528309 CTGAGGAAAGGCTGCCAAGAAGG - Intergenic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1009539810 6:64940097-64940119 CTCTGGATAAGTTGTCAAGAAGG - Intronic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012666471 6:101977293-101977315 CTGTGAACCAGATGCCAAGATGG + Intronic
1013515797 6:110884675-110884697 CTGTGGTTCAGAGGCCAAGAAGG - Intronic
1014206128 6:118657217-118657239 CTGAGGATGAGTTACCAGGAAGG + Intronic
1014441580 6:121479758-121479780 CTTTGGATAATTAGCCAAGATGG + Intergenic
1029299754 7:99571063-99571085 CAGGGGATAAGAGGCCAAGAAGG - Intronic
1030597786 7:111561214-111561236 CTTTTGAAAAGTTGCCAAAAAGG - Intronic
1032372602 7:131373658-131373680 TTATGGAAAAGTTGCAAAGATGG + Intronic
1033214630 7:139484132-139484154 CTGTGGAAAAGTAGCCCAGTTGG + Intergenic
1033723775 7:144090092-144090114 CTGTTGTTACTTTGCCAAGAAGG - Intergenic
1035035923 7:155893661-155893683 CTGTGAATAAGTTGACAAATTGG - Intergenic
1037005770 8:13777810-13777832 TTGTGGATAAGTCACAAAGATGG - Intergenic
1038027278 8:23602925-23602947 CTGGGGAGAAGTTGCCACGATGG - Intergenic
1041737001 8:61121381-61121403 CGGTGAATAAGGAGCCAAGATGG - Intronic
1042864279 8:73343989-73344011 CTTTGGACAGGTTGGCAAGAGGG - Intergenic
1043949496 8:86291991-86292013 CTGTGGATAGGTGTCCAGGAAGG - Intronic
1044539526 8:93393769-93393791 CTGAGAGTATGTTGCCAAGAAGG - Intergenic
1044976357 8:97669526-97669548 CTGGGGATAAGTGGCGGAGAGGG - Intronic
1045709886 8:104970844-104970866 CTGTCAATCAGTTGTCAAGATGG + Intronic
1050566802 9:6893211-6893233 CTATGGAAAAGTTGCCAAATTGG + Exonic
1053135681 9:35649173-35649195 CTGGGGATGAGGGGCCAAGAGGG - Intergenic
1053596593 9:39568327-39568349 CTGAGGATTTGCTGCCAAGACGG - Intergenic
1053854559 9:42324967-42324989 CTGAGGATTTGCTGCCAAGATGG - Intergenic
1054569664 9:66796675-66796697 CTGAGGATTTGCTGCCAAGACGG + Intergenic
1057111969 9:92480712-92480734 CAGGGGAAAAGTTGCCAAGCGGG - Intronic
1060690947 9:125659603-125659625 CTGTTCATGAGTTGGCAAGAGGG - Intronic
1060822591 9:126670040-126670062 TTCTGGAAAAGTTGCCAGGAAGG - Intronic
1061333848 9:129916146-129916168 CTGTGCAAAAGTTCACAAGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187425914 X:19176910-19176932 GTGTGAATAAGCTGCCCAGAGGG + Intergenic
1188122196 X:26321148-26321170 CTTGGGATATGTAGCCAAGAAGG + Intergenic
1192891599 X:75397597-75397619 CTGGGGAGTAGTGGCCAAGATGG + Intronic
1195419453 X:104657443-104657465 TTGTGTATAAGTTGTAAAGAAGG - Intronic
1195760955 X:108245921-108245943 CTGTATAGAAGTGGCCAAGAGGG + Intronic
1199232880 X:145459631-145459653 TTGAGTATAAGTTGCCTAGATGG + Intergenic