ID: 975281050

View in Genome Browser
Species Human (GRCh38)
Location 4:72563373-72563395
Sequence GTGTGGTGAAGGAGGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975281050_975281056 -4 Left 975281050 4:72563373-72563395 CCCCTAAACCTCCTTCACCACAC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 975281056 4:72563392-72563414 ACACTTTCTAGTACTGCTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 109
975281050_975281057 4 Left 975281050 4:72563373-72563395 CCCCTAAACCTCCTTCACCACAC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 975281057 4:72563400-72563422 TAGTACTGCTGCTGGCAAATTGG 0: 1
1: 0
2: 1
3: 27
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975281050 Original CRISPR GTGTGGTGAAGGAGGTTTAG GGG (reversed) Intronic
900852959 1:5158153-5158175 GAGTGGTGACGGAGGTAGAGGGG - Intergenic
901331464 1:8412452-8412474 GGGAGGTGGAGGAGCTTTAGTGG - Intronic
903004499 1:20289750-20289772 GTGTGGAGAAGGAGGTAGGGTGG + Intergenic
904293981 1:29505860-29505882 GAGTGGTGAAGGAGTTTTTCAGG - Intergenic
904857038 1:33507033-33507055 GTGTGTTATAGGATGTTTAGCGG - Intergenic
905203082 1:36326850-36326872 ATGTGGGGAAGCAGGTTTGGGGG + Intronic
906655443 1:47545046-47545068 GTGTGGTGGAGATGGTTGAGGGG + Intergenic
906769519 1:48471858-48471880 GGAGGGTGAAGGAGGTTTGGGGG + Intronic
906795835 1:48695872-48695894 TGGGGGTGTAGGAGGTTTAGGGG - Intronic
907012493 1:50977359-50977381 GTCTGGAGAAGGAGTTTCAGAGG - Intergenic
908549911 1:65198493-65198515 GTGTGGAAAAGAAGGATTAGAGG + Intronic
908565993 1:65356762-65356784 GTGGGGGGAAGGAGGCCTAGAGG + Intronic
909939380 1:81592774-81592796 GTGTGGGGAAGGAGGTGTAGGGG + Intronic
910226228 1:84939087-84939109 GTGCGGTGAAGGAGGAGTTGAGG + Intronic
913099690 1:115551727-115551749 GTGAGGAGAAGGAGGTTTGGTGG - Intergenic
913199158 1:116482286-116482308 ATGTGGTGAAGGAGAGTTGGAGG - Intergenic
913588472 1:120299676-120299698 GGGGGGTGAAGGAGGGATAGGGG - Intergenic
913619713 1:120598693-120598715 GGGGGGTGAAGGAGGGATAGGGG + Intergenic
915492690 1:156260013-156260035 ATGTGGTGATGGAGATTTAAGGG + Intronic
916056361 1:161071340-161071362 GTGAGGTGAAGGAGGTGCTGGGG - Exonic
918045682 1:180939637-180939659 GTGTGGAGAAGGAAATGTAGGGG - Intronic
918138615 1:181700854-181700876 GTGAGCGGAAGGAAGTTTAGAGG - Intronic
919986681 1:202680634-202680656 GTGTGGTTAAGTAGGATTTGGGG - Intronic
920128184 1:203710512-203710534 GTGTGGTGCTGGTGGTTTGGGGG - Intronic
920771208 1:208887812-208887834 GTATGGTTAATGAGGTTGAGGGG + Intergenic
923086812 1:230708588-230708610 CTGTGGAGAAAGAGGTTCAGTGG - Intronic
923224900 1:231930242-231930264 GTGAGGTCAGGGAAGTTTAGTGG + Intronic
923457725 1:234179096-234179118 GAGTCGTGAAGGAGGCTCAGTGG - Intronic
1062885177 10:1010901-1010923 GGGTGGGGAAGGTGGTGTAGGGG - Intronic
1063167925 10:3480628-3480650 GGGGGGTGGAGGAGGTTCAGGGG - Intergenic
1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG + Intronic
1065758519 10:28958852-28958874 GTAGGGAGAAGGAGGTTAAGGGG + Intergenic
1067159609 10:43813230-43813252 GTGTGGTGAGGTGGGCTTAGAGG + Intergenic
1068795419 10:61074046-61074068 ATGTGGTGAAGGAGATTCAGAGG + Intergenic
1069780477 10:70952342-70952364 ATGTGGTGATGGAGATTTTGGGG + Intergenic
1069801302 10:71083579-71083601 GTGTGGGGAAGGAGACTCAGGGG + Intergenic
1071248861 10:83795053-83795075 GTGTGGTGAAAGAGGGCAAGGGG - Intergenic
1072311129 10:94156517-94156539 GTGTGGGGAAGGAAGTGTGGAGG + Intronic
1074476812 10:113781433-113781455 GTGTTGGGAAGGAGGTGTTGGGG - Intronic
1074476830 10:113781484-113781506 GTGTTGGGAAGGAGGTGTTGGGG - Intronic
1074476907 10:113781746-113781768 GTGTTGGGAAGGAGGTGTTGGGG - Intronic
1076053291 10:127352107-127352129 GGGTGGTGAAGGAGGCTGAGGGG - Intronic
1078637224 11:13063316-13063338 GTGTGGAGAATGAGGTCGAGGGG - Intergenic
1081957365 11:47105074-47105096 GTGTAGTGAAGGATGGTTTGAGG + Intronic
1082781238 11:57289095-57289117 GTGTGGTGAAGCAGGGCTGGAGG + Intergenic
1083313201 11:61796515-61796537 CTGGGGTGAAGGAGGTATAATGG - Exonic
1083455964 11:62778776-62778798 GTGTGGGGATGGTGGTTGAGGGG + Intronic
1085644216 11:78212852-78212874 GTGTGCTGAAGGAGGAGTACAGG + Intronic
1086367738 11:86124855-86124877 GTGTGGAGAATGAAATTTAGAGG + Intergenic
1086803279 11:91204680-91204702 GTGTGGTGAAGGAGAATTGAAGG - Intergenic
1087204632 11:95381120-95381142 GTGTGTGGTAGGATGTTTAGCGG + Intergenic
1090245327 11:125212251-125212273 GTGTGCTGAACGAGGTAGAGGGG + Intronic
1091758317 12:3070705-3070727 ATGTGGTCAAGGAGGTGAAGTGG + Intergenic
1091761104 12:3087927-3087949 GTGTGGAGACTGAGGCTTAGGGG + Intronic
1093682386 12:22017341-22017363 CTGAGGTGGAGGAGGTTTGGTGG + Intergenic
1095265952 12:40157963-40157985 GTGAGGAGAAGGAAGGTTAGTGG - Intergenic
1095928481 12:47603302-47603324 GTGTGTGGAAGGAGGTGTGGGGG - Intergenic
1096589979 12:52651734-52651756 TGGTGGTGTTGGAGGTTTAGGGG - Exonic
1097183354 12:57183540-57183562 GCGTGGCGTAGGAGCTTTAGGGG + Intronic
1098831807 12:75373254-75373276 GTCTGGGGAAGAAGGTTGAGTGG + Intronic
1099080735 12:78177181-78177203 ATGTGATGAAGGAGGCTTGGTGG - Exonic
1099415674 12:82383037-82383059 TTGTGGAGAGGGAGGTGTAGAGG + Intronic
1099509257 12:83513062-83513084 GGATGGTGAGGGAGGTTAAGTGG + Intergenic
1100706802 12:97209650-97209672 GTGTGGTGTAGGTAGTGTAGTGG + Intergenic
1101785577 12:107880575-107880597 GTGTGATCATGGAGGATTAGAGG + Intergenic
1101919539 12:108921239-108921261 GTGTGGGGAAAGGGTTTTAGAGG + Intronic
1102890587 12:116555768-116555790 GTGTGTTGGAGGATGTTTCGAGG + Intergenic
1104383610 12:128329434-128329456 GTGTGGTAAAGGTGGTTTGGCGG + Intronic
1105235752 13:18551677-18551699 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1105783399 13:23724097-23724119 ATGTGATGAAGGAGGTTGAGAGG + Intergenic
1106408051 13:29491003-29491025 GTGTGGTGTGGGAGGTATGGGGG + Intronic
1107182140 13:37473251-37473273 GCGTGGTGGGGGAGGTTTGGAGG - Intergenic
1107373832 13:39781064-39781086 GAGTTGTGAAAGAGATTTAGAGG - Intronic
1108079553 13:46720415-46720437 GTGTGTTGAAAGAGGTGAAGAGG - Intronic
1108536867 13:51391918-51391940 CTGGGGAGAAGCAGGTTTAGGGG - Intronic
1110266081 13:73539153-73539175 GTGAGGGAAAGGAGTTTTAGAGG - Intergenic
1114586311 14:23817230-23817252 GTCTGGTGCAGGAGCTTCAGGGG - Intergenic
1114616824 14:24072824-24072846 GTCTAGGGAAGGAGGTTAAGGGG + Intronic
1118001534 14:61527774-61527796 GTATGGTGGAGGAGGCTGAGGGG - Intronic
1118327687 14:64792650-64792672 CTCTGGAGAAGGAGGTTGAGAGG - Intronic
1119889735 14:78173891-78173913 GAGTGGGGAAAGAGGTTAAGGGG - Intergenic
1121412935 14:93760388-93760410 GGGTGGTATAGGAGGTTTTGGGG - Intronic
1122051652 14:99065041-99065063 GTGGGTTGAAGGCGTTTTAGTGG - Intergenic
1122412623 14:101533731-101533753 GTGTGGTGAGGGAGGGAGAGTGG + Intergenic
1123768073 15:23501456-23501478 GTGTGATGAGGAAGGTTTTGAGG + Intergenic
1123960238 15:25390871-25390893 GTGTGTGGAAGGAGGTACAGGGG + Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124194127 15:27605798-27605820 GTGTGGTGCAGGATGTTCAACGG - Intergenic
1129538506 15:76333197-76333219 ATGTGGTAGAGGAGGTTTTGGGG + Intergenic
1131508029 15:93033297-93033319 GAGTGGTGATGGGGCTTTAGGGG + Intergenic
1131976435 15:97950884-97950906 GTGTGTTGTGTGAGGTTTAGAGG - Intergenic
1131993359 15:98111308-98111330 GTGTGGTGCAGGAGTGTTAGAGG + Intergenic
1134856692 16:17525890-17525912 GTGCGCTGCAGGAGGCTTAGCGG - Intergenic
1135799998 16:25484846-25484868 GGGTGGTGAAAGAGCTCTAGAGG - Intergenic
1137393782 16:48102778-48102800 GTGTGGTGCAGGAGGAGAAGCGG - Intronic
1137821388 16:51449160-51449182 TGGTGGTGAAGGAGGTCTGGTGG + Intergenic
1141355859 16:83346164-83346186 GTGTGCTGGAGGGTGTTTAGGGG + Intronic
1141516112 16:84546256-84546278 GTGCATTGCAGGAGGTTTAGCGG + Intronic
1141951529 16:87343030-87343052 GTGTGGTGAGGGAGGGGTCGTGG - Intronic
1142597115 17:1035328-1035350 GTGGGGGGGAGCAGGTTTAGGGG - Intronic
1144322595 17:14144458-14144480 TTGTGGTGAAGGAGCACTAGTGG + Intronic
1144872613 17:18380433-18380455 CTGGGGTGGAGGAGGTATAGGGG + Intronic
1147335291 17:39723812-39723834 GGGTGGTGAAGGATGTTTGGAGG + Intronic
1147442771 17:40457573-40457595 GTGTGGGGAGGGAGGTGTAGGGG - Exonic
1149335314 17:55629721-55629743 GTGGGGGGAAGGAGGCTTACAGG - Intergenic
1151748639 17:76024589-76024611 CTGGGGTGGAGGAGGTATAGGGG - Intronic
1152117455 17:78397373-78397395 GTGTGGAGAGGGAGGTGCAGTGG + Intronic
1152294032 17:79456367-79456389 GTGTGCTGTAGGATGTTTACTGG + Intronic
1152441632 17:80313407-80313429 CTGTGGTGATGGAGGTGTGGAGG + Intronic
1154002514 18:10494517-10494539 GTGTGGGGAAGGAGGATGGGAGG - Intergenic
1154513788 18:15138321-15138343 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
1157815607 18:50727706-50727728 GTGAGGTGCACCAGGTTTAGGGG - Intronic
1158722168 18:59935273-59935295 GTGAGGTGCAGGGGGTTGAGAGG + Intergenic
1159176896 18:64848132-64848154 GTGTGGGGCAGGAGGTTATGTGG + Intergenic
1160051841 18:75440966-75440988 GTGTGGTGAGGGAGGGATGGAGG + Intergenic
1160171499 18:76559156-76559178 CTGTGGTGACAGAGGTTTAACGG - Intergenic
1163203144 19:15782538-15782560 GTGGGGTGGGGGAGGTCTAGGGG - Intergenic
1165732971 19:38158261-38158283 GTGTGCAGAAGGAGATTTACAGG + Intronic
1165984542 19:39756556-39756578 GTGAGGAGAAGCAGGTTTATCGG - Intergenic
1166063665 19:40343580-40343602 GTGTGGGGAAGGAGGCCTGGAGG - Intronic
1166200566 19:41234893-41234915 GTGTGGTTATGGGGGTTTTGTGG + Intronic
1166545771 19:43634362-43634384 ATGTGGAGAATGAGGCTTAGCGG + Intronic
1167244491 19:48365237-48365259 GTGTGGTGAGGGAGCTTTCTGGG - Intronic
1168081936 19:54016447-54016469 GTGTGGTCAGGGAGGGTTTGGGG - Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926211165 2:10870600-10870622 ATGTGGTGAAGGATATTGAGAGG + Intergenic
927960271 2:27236892-27236914 GTGTGGTGAAGGATGGCTGGGGG + Intronic
928241752 2:29592538-29592560 GTGAGGAGAAGGAGGCTTTGTGG - Intronic
929763332 2:44824250-44824272 GTGTGGTGGAACAGTTTTAGAGG + Intergenic
930234407 2:48875027-48875049 GAGTGGGGAAGGAAGTTGAGTGG + Intergenic
931229850 2:60364989-60365011 AGATGGCGAAGGAGGTTTAGAGG + Intergenic
935098578 2:99970666-99970688 GGGAGGAGAAGGAGGGTTAGAGG - Intronic
935795790 2:106640529-106640551 GTGTGTTGTAGGATGTTTAGTGG - Intergenic
937595268 2:123664597-123664619 GTGGAGTGAAGGAGGGGTAGTGG + Intergenic
937967184 2:127522237-127522259 GTGTGGATATGGACGTTTAGGGG - Intronic
938514031 2:131982932-131982954 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
939767366 2:146267407-146267429 GGGGGGTGAAGGAGGGTGAGAGG + Intergenic
940629028 2:156213932-156213954 CTGTTGTAAAGCAGGTTTAGTGG + Intergenic
941383410 2:164823481-164823503 CTGCGGTGAAGGAGGGTAAGAGG - Intronic
941633488 2:167909843-167909865 GGGTGGGGCAGGAGGTTTATGGG - Intergenic
941870274 2:170377312-170377334 GAGTGGGAAAGGAGCTTTAGAGG - Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
943818787 2:192291913-192291935 ATGTGGTGAAGGAGTTTTGATGG + Intergenic
946071886 2:217041149-217041171 GTGTGGTGAAGGAAGATTGAAGG - Intergenic
946596831 2:221315142-221315164 GTGTGGTGGTGCAGGTTTTGGGG - Intergenic
946895363 2:224318595-224318617 GTGTGGGGAGGGAGGTTGAGAGG - Intergenic
948586460 2:239023018-239023040 GTGTGATGGAGGAGATGTAGAGG + Intergenic
948843591 2:240672396-240672418 GGGTGGTGAAGGAGGTGTCGCGG - Intergenic
1169966110 20:11219181-11219203 GTGTGGTGGAGAAGCTTCAGGGG + Intergenic
1170358022 20:15513428-15513450 GTGTGTGGAAGGGGGTTTGGGGG - Intronic
1170404000 20:16017431-16017453 GTGTTGTGAAGGATATTTTGAGG + Intronic
1171943077 20:31349589-31349611 GTGAGATGAAGGAAATTTAGGGG + Intergenic
1172606846 20:36219811-36219833 GGGTGGTGGTGGAGGTTGAGAGG - Exonic
1172940341 20:38649724-38649746 AAGGGGTGAAGGAGGTTGAGTGG - Intronic
1175498908 20:59435478-59435500 GGGTGGGGAAGGAGGTGAAGAGG - Intergenic
1176779753 21:13179963-13179985 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1177913274 21:27056985-27057007 GGCTGGGGAAGGAGGCTTAGTGG - Intergenic
1177977398 21:27868998-27869020 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1178286518 21:31329938-31329960 GTGTGGGGCAGGAGGTATATGGG - Intronic
1180049404 21:45324445-45324467 GTGGGGTGAAGGATGTGGAGGGG + Intergenic
1180081592 21:45489997-45490019 GTGTGGGGGAGGAGGTGTGGGGG - Intronic
1183523897 22:38312568-38312590 GTGTGGTGCAGCTGGTTTAAAGG - Intronic
949758587 3:7442583-7442605 GTGTGCTTAAGGAGGTGAAGGGG + Intronic
950361245 3:12450813-12450835 GTGTGGGGGAGGAGATTTAGAGG + Intergenic
950701601 3:14754123-14754145 GGGTGGGGAAGGAGGTATATGGG - Intronic
952045510 3:29314051-29314073 CTGTGGTGGTGGAGGTATAGGGG + Intronic
953026555 3:39148479-39148501 GTGTGGTGAAGGAGGCATTCAGG - Intronic
953484631 3:43283997-43284019 GGGTGGTGAAGGAGTCTTTGAGG + Intergenic
954160537 3:48718454-48718476 GTGGGGTGAAGTAGGTTTGGCGG - Intronic
955660111 3:61289745-61289767 TTGTGGAGAATGAGCTTTAGGGG + Intergenic
955939541 3:64134521-64134543 GTGCACTGTAGGAGGTTTAGCGG + Intronic
956656412 3:71557462-71557484 ATGAGGTGAAGGAGTTTTGGAGG - Intronic
961716477 3:128861106-128861128 GTGGGGTGCAGGAGGTGAAGGGG + Intergenic
962070999 3:132034074-132034096 GTGTGGGGGAGGAGGTTGAGAGG + Intronic
962321279 3:134392663-134392685 GTGTGGAGAAGGAGGATCAGTGG + Intergenic
963097487 3:141560422-141560444 GTGTGGTGAAGGAAGAACAGTGG - Intronic
963154076 3:142077438-142077460 GAGTGGAGAAGGAAGTTAAGAGG + Intronic
963379147 3:144506509-144506531 GTCTGGGGAAGGAGGCTGAGTGG + Intergenic
963567972 3:146954322-146954344 GTTTGGGGAAGGGGGTTTTGGGG + Intergenic
964607446 3:158572690-158572712 GTGTGGGGAAGAGGGTTTAGGGG + Intronic
966739469 3:183218758-183218780 GTTTTGTGAAGGAGGGTTAGCGG - Intronic
974165587 4:58197335-58197357 GTGGGGTCAAGCAGGTTTGGAGG + Intergenic
974838040 4:67274171-67274193 GTGAGCTGAAGCAGGGTTAGGGG - Intergenic
975281050 4:72563373-72563395 GTGTGGTGAAGGAGGTTTAGGGG - Intronic
976466556 4:85376113-85376135 AGGAGGTGAATGAGGTTTAGGGG - Intergenic
978755498 4:112297650-112297672 GTGGGGTGAAGGGGGTGGAGTGG + Intronic
979099584 4:116598712-116598734 GTGGGGTGACGGTGGTGTAGGGG - Intergenic
979515105 4:121598653-121598675 GTGTGGGGCAGGAGGTATATGGG + Intergenic
982088686 4:151861946-151861968 TTGTGGTGAAGCAGGATAAGGGG + Intergenic
983412780 4:167420474-167420496 GTTTGGTGAAGGATTTTTAAGGG - Intergenic
984743926 4:183195377-183195399 GTGTTGAGAAGGAGGCTAAGAGG - Intronic
989705114 5:44320638-44320660 ATGTGGTGAAGAAGTTTTAAAGG - Intronic
991311091 5:65242860-65242882 GTGTGGAGAGGGATGTTAAGAGG + Intronic
993681513 5:90884173-90884195 GTGTATTGTAGGATGTTTAGCGG + Intronic
995819898 5:116218188-116218210 CTTTGGAGAAGCAGGTTTAGCGG + Intronic
997454714 5:134007926-134007948 GGGTGGAGAAGGAGGTTTGTGGG + Intergenic
997607340 5:135184682-135184704 GTGTAGTGAAGGCAGATTAGGGG - Intronic
997745831 5:136299375-136299397 GTGTGGTGGAGGAGGAGGAGGGG + Intronic
997868296 5:137484113-137484135 TTGTGGTGGAGGAGGTTGAGAGG - Intronic
998516748 5:142762501-142762523 GTTTGTTGAAGGTGGCTTAGTGG - Intergenic
998975838 5:147645738-147645760 GTGCAGTGGAGGATGTTTAGCGG + Intronic
999696674 5:154193137-154193159 AAGTGGTGAAGGGGGTTTGGGGG + Intronic
1001332585 5:170772710-170772732 GTGTGGGGAAGGAGGGGTGGTGG + Intronic
1002909544 6:1478810-1478832 TTGTGGTGAAGGTGGTATTGTGG + Intergenic
1003152911 6:3567640-3567662 GGAAGGTGAAGGAGTTTTAGGGG + Intergenic
1005651762 6:27891559-27891581 GTGTGGGGAAGGAGTTTGATAGG + Intronic
1005714339 6:28532618-28532640 GTGTGGTGAAGAAAGTTGTGTGG + Intronic
1007216615 6:40244980-40245002 GTGTGGAGAAGCAGTTGTAGTGG - Intergenic
1011384065 6:86775218-86775240 GTGTGGTGATGGGGCTTGAGGGG - Intergenic
1012298066 6:97549377-97549399 GTGTGTTGAAGCAGGTGTGGGGG + Intergenic
1013958600 6:115870208-115870230 GGGTGGTGAAGGAGGAGCAGAGG - Intergenic
1017896127 6:158681709-158681731 GTGTGTTGATGGAGATTTGGGGG - Intronic
1018402649 6:163440641-163440663 GTGTTATGAAGTATGTTTAGAGG + Intronic
1018480020 6:164180888-164180910 GTGGGGTGAGAGAGGTTGAGAGG + Intergenic
1019099864 6:169620808-169620830 GTGTGGTGAAGCCGGTGGAGGGG - Intronic
1019188545 6:170236125-170236147 GAGTGGTGCAGGGGGGTTAGAGG - Intergenic
1021583460 7:22182055-22182077 GTGTGAGGAAGGAGTATTAGTGG - Intronic
1024024636 7:45400158-45400180 GGGTGGTGGGGGAGGTTTATGGG - Intergenic
1024306125 7:47931081-47931103 GTACGGTGAAGGAGGTATGGAGG - Intronic
1025625750 7:63219721-63219743 GGGTGGTGTAGGAGGGTTATGGG + Intergenic
1027841923 7:83323793-83323815 CTGTGGTGATGCAGGTGTAGGGG - Intergenic
1028388240 7:90284667-90284689 GTGAGGTAAAGGTAGTTTAGAGG + Intronic
1031410794 7:121438355-121438377 CTGTGGTCAAGAAGGATTAGGGG - Intergenic
1032470902 7:132178297-132178319 GTGGGGTGAAGGTGCTCTAGTGG + Intronic
1032909434 7:136412854-136412876 GTGTGGTGAAGGAGGAGGTGTGG + Intergenic
1033142304 7:138838395-138838417 GAGAGCTGAAGGAGGTTAAGCGG + Intronic
1034441880 7:151089849-151089871 GTGAGGTGAAGGTGGCTCAGAGG - Intronic
1035600768 8:895681-895703 GTGGTGTGAAGGAGGGTTATGGG + Intergenic
1036132973 8:6133522-6133544 GGGAGGTGAAGGAGGTCTGGAGG + Intergenic
1038419708 8:27425509-27425531 GTGTGGGGAAGGGGGTATATAGG - Intronic
1039105448 8:33984580-33984602 GGGAGGTGAAGGAGTCTTAGAGG + Intergenic
1040815483 8:51503949-51503971 GTATGGTGAAGGAGGATTCCTGG - Intronic
1043950004 8:86298535-86298557 GGGTGATGATGGAGGTTGAGTGG - Intronic
1043993866 8:86788689-86788711 GTGAGGTGAAGGAGGTATGTAGG + Intergenic
1045978846 8:108160612-108160634 GTTGTGTGAAGGAGGTTTAGTGG - Intergenic
1046711689 8:117518039-117518061 GTGTGGTAAAGAAGGTTGGGAGG + Intergenic
1047695107 8:127395632-127395654 CAGTGGTGGAGGAGGTTAAGGGG - Intergenic
1048379180 8:133849234-133849256 GTGTGGTGGATGAGATTTACTGG + Intergenic
1048738002 8:137523086-137523108 GGGTGGTGAAGGATGAGTAGGGG - Intergenic
1050877755 9:10661331-10661353 GTGATGTGAAGGAGGTTGTGAGG + Intergenic
1052978226 9:34427851-34427873 GTGAGTTGAAGGAGGGTTTGGGG - Intronic
1053295902 9:36912765-36912787 TTGTGGAGAAGGAGGCTTGGAGG - Intronic
1055975566 9:81951506-81951528 GGATGGTGAAGGAGCTGTAGTGG - Intergenic
1056251471 9:84752888-84752910 ATGCTGTGAAGAAGGTTTAGTGG + Intronic
1056525985 9:87443420-87443442 GTCTGGTGAAGGATGCTTACTGG + Intergenic
1058019999 9:100076834-100076856 GGCTGGGGAAGGAGGCTTAGTGG - Intronic
1058120478 9:101133166-101133188 GTGTGGTAAAGGAAATTTTGTGG - Intronic
1059255399 9:112925909-112925931 GTGTGCTAGAGGAGCTTTAGGGG + Intergenic
1060684339 9:125594688-125594710 GTGTGGGGAAGGAGGTGGTGAGG - Intronic
1061582368 9:131545844-131545866 GGGTGCTGGAGGGGGTTTAGCGG + Intergenic
1062379295 9:136279441-136279463 GGATGGTGAATGAGGTATAGGGG + Intergenic
1186182830 X:6989694-6989716 ATGTGGTGCAGGAGGTTTTATGG + Intergenic
1187917752 X:24171226-24171248 TTGTGGGGAAGGAGATTTAGAGG + Intronic
1188165367 X:26856419-26856441 GTGAGGTGAATGTGGGTTAGGGG - Intergenic
1190798502 X:53767120-53767142 GTGTGGAGAATGAGTTTTAGTGG + Intergenic
1191977879 X:66893849-66893871 GGGTGGAGAAGGAGGGTTACAGG + Intergenic
1192763899 X:74123605-74123627 ATGAGGTAAAGGAGGTTTGGAGG + Intergenic
1193824746 X:86209693-86209715 GTGAGTGGAAGGAGGCTTAGAGG + Intronic
1195424049 X:104707698-104707720 GTGTTTTGAATGATGTTTAGAGG + Intronic
1196704195 X:118702643-118702665 GTGGGGAGAAGTAGGTTTATGGG - Intergenic
1196755729 X:119155638-119155660 TTGTAGTGGAGGAGATTTAGAGG + Intergenic
1196950796 X:120874756-120874778 GGGTGGTGAAGCAGGTGTTGGGG - Intronic