ID: 975286890

View in Genome Browser
Species Human (GRCh38)
Location 4:72631655-72631677
Sequence CTAGTTTTCCTGGACTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975286884_975286890 19 Left 975286884 4:72631613-72631635 CCTGGCTGCCTCTTTGCTTGTGG No data
Right 975286890 4:72631655-72631677 CTAGTTTTCCTGGACTAATCTGG No data
975286886_975286890 11 Left 975286886 4:72631621-72631643 CCTCTTTGCTTGTGGATTGAACC No data
Right 975286890 4:72631655-72631677 CTAGTTTTCCTGGACTAATCTGG No data
975286887_975286890 -10 Left 975286887 4:72631642-72631664 CCTGATGCCTGCTCTAGTTTTCC No data
Right 975286890 4:72631655-72631677 CTAGTTTTCCTGGACTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975286890 Original CRISPR CTAGTTTTCCTGGACTAATC TGG Intergenic
No off target data available for this crispr