ID: 975292151

View in Genome Browser
Species Human (GRCh38)
Location 4:72689402-72689424
Sequence GCCACAGTGGGAAAAGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975292140_975292151 27 Left 975292140 4:72689352-72689374 CCCATATGTCCAAGTGCATGTGC No data
Right 975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG No data
975292143_975292151 18 Left 975292143 4:72689361-72689383 CCAAGTGCATGTGCGCGAGGACC No data
Right 975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG No data
975292141_975292151 26 Left 975292141 4:72689353-72689375 CCATATGTCCAAGTGCATGTGCG No data
Right 975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG No data
975292145_975292151 -3 Left 975292145 4:72689382-72689404 CCTTTGTGGTATGACACAGAGCC No data
Right 975292151 4:72689402-72689424 GCCACAGTGGGAAAAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975292151 Original CRISPR GCCACAGTGGGAAAAGAAGG GGG Intergenic
No off target data available for this crispr