ID: 975295297

View in Genome Browser
Species Human (GRCh38)
Location 4:72727186-72727208
Sequence TGGTTACCACTGATGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975295297_975295302 2 Left 975295297 4:72727186-72727208 CCATGGGCCATCAGTGGTAACCA No data
Right 975295302 4:72727211-72727233 CAATAGTCACCACAGACCTTGGG No data
975295297_975295306 30 Left 975295297 4:72727186-72727208 CCATGGGCCATCAGTGGTAACCA No data
Right 975295306 4:72727239-72727261 CCCAGTACTATGCTTGCTGCAGG No data
975295297_975295301 1 Left 975295297 4:72727186-72727208 CCATGGGCCATCAGTGGTAACCA No data
Right 975295301 4:72727210-72727232 GCAATAGTCACCACAGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975295297 Original CRISPR TGGTTACCACTGATGGCCCA TGG (reversed) Intergenic
No off target data available for this crispr