ID: 975298791

View in Genome Browser
Species Human (GRCh38)
Location 4:72765930-72765952
Sequence TCCTGCTGGCCTGCAAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975298791_975298802 25 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298802 4:72765978-72766000 GACCCTGCACTGGGAGCAGCGGG No data
975298791_975298795 -6 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298795 4:72765947-72765969 GCAGGAGTTCCGTGTGGGCGTGG No data
975298791_975298801 24 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298801 4:72765977-72765999 TGACCCTGCACTGGGAGCAGCGG No data
975298791_975298806 29 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298806 4:72765982-72766004 CTGCACTGGGAGCAGCGGGTGGG No data
975298791_975298797 0 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298797 4:72765953-72765975 GTTCCGTGTGGGCGTGGGCTCGG No data
975298791_975298805 28 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298805 4:72765981-72766003 CCTGCACTGGGAGCAGCGGGTGG No data
975298791_975298796 -5 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298796 4:72765948-72765970 CAGGAGTTCCGTGTGGGCGTGGG No data
975298791_975298799 15 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298799 4:72765968-72765990 GGGCTCGGCTGACCCTGCACTGG No data
975298791_975298800 16 Left 975298791 4:72765930-72765952 CCGGTGCTTGCAGGCCAGCAGGA No data
Right 975298800 4:72765969-72765991 GGCTCGGCTGACCCTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975298791 Original CRISPR TCCTGCTGGCCTGCAAGCAC CGG (reversed) Intergenic
No off target data available for this crispr