ID: 975301671

View in Genome Browser
Species Human (GRCh38)
Location 4:72797748-72797770
Sequence CCCTCTAGACCCCAGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975301671_975301684 23 Left 975301671 4:72797748-72797770 CCACCATTCTGGGGTCTAGAGGG No data
Right 975301684 4:72797794-72797816 CACTAGGCAGTTTCCCAGTGGGG No data
975301671_975301681 21 Left 975301671 4:72797748-72797770 CCACCATTCTGGGGTCTAGAGGG No data
Right 975301681 4:72797792-72797814 TCCACTAGGCAGTTTCCCAGTGG No data
975301671_975301683 22 Left 975301671 4:72797748-72797770 CCACCATTCTGGGGTCTAGAGGG No data
Right 975301683 4:72797793-72797815 CCACTAGGCAGTTTCCCAGTGGG 0: 4
1: 165
2: 1250
3: 1772
4: 1709
975301671_975301685 24 Left 975301671 4:72797748-72797770 CCACCATTCTGGGGTCTAGAGGG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301671_975301677 7 Left 975301671 4:72797748-72797770 CCACCATTCTGGGGTCTAGAGGG No data
Right 975301677 4:72797778-72797800 CCTCCTCCCACAGTTCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975301671 Original CRISPR CCCTCTAGACCCCAGAATGG TGG (reversed) Intergenic
No off target data available for this crispr