ID: 975301675

View in Genome Browser
Species Human (GRCh38)
Location 4:72797777-72797799
Sequence CTAGTGGAACTGTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975301675_975301686 5 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301686 4:72797805-72797827 TTCCCAGTGGGGGCTCTGTATGG No data
975301675_975301683 -7 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301683 4:72797793-72797815 CCACTAGGCAGTTTCCCAGTGGG 0: 4
1: 165
2: 1250
3: 1772
4: 1709
975301675_975301684 -6 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301684 4:72797794-72797816 CACTAGGCAGTTTCCCAGTGGGG No data
975301675_975301685 -5 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301675_975301681 -8 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301681 4:72797792-72797814 TCCACTAGGCAGTTTCCCAGTGG No data
975301675_975301689 7 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301689 4:72797807-72797829 CCCAGTGGGGGCTCTGTATGGGG 0: 3
1: 68
2: 716
3: 1727
4: 1869
975301675_975301691 8 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301691 4:72797808-72797830 CCAGTGGGGGCTCTGTATGGGGG 0: 3
1: 49
2: 668
3: 1513
4: 1726
975301675_975301687 6 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301687 4:72797806-72797828 TCCCAGTGGGGGCTCTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975301675 Original CRISPR CTAGTGGAACTGTGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr