ID: 975301678

View in Genome Browser
Species Human (GRCh38)
Location 4:72797781-72797803
Sequence CTGCCTAGTGGAACTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975301678_975301685 -9 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301678_975301684 -10 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301684 4:72797794-72797816 CACTAGGCAGTTTCCCAGTGGGG No data
975301678_975301687 2 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301687 4:72797806-72797828 TCCCAGTGGGGGCTCTGTATGGG No data
975301678_975301686 1 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301686 4:72797805-72797827 TTCCCAGTGGGGGCTCTGTATGG No data
975301678_975301689 3 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301689 4:72797807-72797829 CCCAGTGGGGGCTCTGTATGGGG 0: 3
1: 68
2: 716
3: 1727
4: 1869
975301678_975301691 4 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301691 4:72797808-72797830 CCAGTGGGGGCTCTGTATGGGGG 0: 3
1: 49
2: 668
3: 1513
4: 1726
975301678_975301692 27 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301692 4:72797831-72797853 CTCCCAGCCACATTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975301678 Original CRISPR CTGCCTAGTGGAACTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr