ID: 975301685

View in Genome Browser
Species Human (GRCh38)
Location 4:72797795-72797817
Sequence ACTAGGCAGTTTCCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975301678_975301685 -9 Left 975301678 4:72797781-72797803 CCTCCCACAGTTCCACTAGGCAG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301673_975301685 21 Left 975301673 4:72797751-72797773 CCATTCTGGGGTCTAGAGGGTGA No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301675_975301685 -5 Left 975301675 4:72797777-72797799 CCCTCCTCCCACAGTTCCACTAG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301671_975301685 24 Left 975301671 4:72797748-72797770 CCACCATTCTGGGGTCTAGAGGG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data
975301676_975301685 -6 Left 975301676 4:72797778-72797800 CCTCCTCCCACAGTTCCACTAGG No data
Right 975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975301685 Original CRISPR ACTAGGCAGTTTCCCAGTGG GGG Intergenic
No off target data available for this crispr