ID: 975322217

View in Genome Browser
Species Human (GRCh38)
Location 4:73021577-73021599
Sequence CACAAGAGGGTAAAACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975322217_975322222 7 Left 975322217 4:73021577-73021599 CCCTGAGGTTTTACCCTCTTGTG No data
Right 975322222 4:73021607-73021629 TCTGAATTATCTGCCCAAGGAGG No data
975322217_975322221 4 Left 975322217 4:73021577-73021599 CCCTGAGGTTTTACCCTCTTGTG No data
Right 975322221 4:73021604-73021626 TTTTCTGAATTATCTGCCCAAGG No data
975322217_975322225 20 Left 975322217 4:73021577-73021599 CCCTGAGGTTTTACCCTCTTGTG No data
Right 975322225 4:73021620-73021642 CCCAAGGAGGGAGAAAACAAAGG No data
975322217_975322223 8 Left 975322217 4:73021577-73021599 CCCTGAGGTTTTACCCTCTTGTG No data
Right 975322223 4:73021608-73021630 CTGAATTATCTGCCCAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975322217 Original CRISPR CACAAGAGGGTAAAACCTCA GGG (reversed) Intergenic
No off target data available for this crispr