ID: 975322360

View in Genome Browser
Species Human (GRCh38)
Location 4:73023191-73023213
Sequence CCTAAAATGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975322360_975322366 11 Left 975322360 4:73023191-73023213 CCTCCCTCCTTCTCCATTTTAGG No data
Right 975322366 4:73023225-73023247 TCTAGCTAAAATCAGAGACTTGG No data
975322360_975322367 12 Left 975322360 4:73023191-73023213 CCTCCCTCCTTCTCCATTTTAGG No data
Right 975322367 4:73023226-73023248 CTAGCTAAAATCAGAGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975322360 Original CRISPR CCTAAAATGGAGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr