ID: 975328696

View in Genome Browser
Species Human (GRCh38)
Location 4:73089383-73089405
Sequence AACAGGCAGCAGGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1236
Summary {0: 2, 1: 26, 2: 105, 3: 329, 4: 774}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975328693_975328696 26 Left 975328693 4:73089334-73089356 CCTATTCTTAAAAAAAAAAATTT 0: 1
1: 3
2: 93
3: 1011
4: 7319
Right 975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG 0: 2
1: 26
2: 105
3: 329
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975328696 Original CRISPR AACAGGCAGCAGGCCAAATT TGG Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
901121594 1:6898849-6898871 AACAGGTAGCTGGCCAACATGGG + Intronic
901176963 1:7310485-7310507 AACAGGCAGTGAGCCAAATTTGG + Intronic
901180739 1:7340201-7340223 TACAGGCAGCAGGCTGAATTTGG + Intronic
901475215 1:9484887-9484909 AACAGGCAGCAGGAGGGATTTGG + Intergenic
901561487 1:10075237-10075259 AACAGGCAGTAGCCCAGATTTGG + Intronic
901777108 1:11567626-11567648 AACAGGCAGTGGGCCGGATTTGG - Intergenic
902190687 1:14760995-14761017 GACAGGCAGCGGGCCAGATTTGG + Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
902750074 1:18502058-18502080 AGCAGGCAGAGGGCCAGATTTGG + Intergenic
902821364 1:18945312-18945334 AATAGGCAGAAGGCCATCTTGGG - Intronic
902930654 1:19728940-19728962 AGCAGCCAGAAGGCCATATTTGG - Intronic
903061007 1:20668728-20668750 AATAGCCTGCAGGCCAGATTTGG - Intronic
903127021 1:21255148-21255170 AACGGACAACAGGTCAAATTCGG + Intronic
903269726 1:22179902-22179924 AACAGGCACCAGGAAGAATTTGG - Intergenic
903526813 1:23996913-23996935 AACAGGCTGCAAGCCAGATTTGG - Intergenic
903727643 1:25462888-25462910 AACAGGCAGTGGGCCAGATTTGG - Intronic
903931078 1:26862952-26862974 AACAGTCAGCAGGAGAAATCTGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905497211 1:38401695-38401717 AAGAGGCAGCAGGTCAGATTTGG - Intergenic
905782498 1:40724431-40724453 AACAGGCTGTAGGCCAGATGTGG + Intronic
905930867 1:41786501-41786523 AACAGGCAGCATCTCAGATTTGG - Intronic
906096156 1:43225465-43225487 AATAGACAGCAGGCCCAATGTGG + Intronic
906137433 1:43509240-43509262 AACAGGTGGCAGGCTAGATTTGG - Intergenic
906500063 1:46335383-46335405 AACAGGCTGCAGGATGAATTTGG + Intergenic
906557888 1:46728824-46728846 AAAAGGCAGCAGCCCCAGTTAGG + Intergenic
906816449 1:48885118-48885140 AACAGGAAACAGACCAGATTTGG - Intronic
907398899 1:54212312-54212334 AATAGGTAGCAGGCCAGATTTGG + Intronic
907485134 1:54772518-54772540 AGCAGGCAGCAGCCAGAATTTGG + Intergenic
907487585 1:54788181-54788203 AAGAGGCAGCAGGCACAAGTGGG + Intronic
907522817 1:55035826-55035848 AAGAGACAGCAGGCTAATTTTGG + Intergenic
907695750 1:56726808-56726830 AACAAGTGGCAGGCCATATTTGG + Intronic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
907974554 1:59418899-59418921 AACTGGCAGCAGGCACATTTGGG + Intronic
908004702 1:59715847-59715869 AACAGTCAGTAGGCAAAATTTGG - Intronic
908018546 1:59874678-59874700 GACAGGCGGTAGGCCAGATTTGG + Exonic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
908615852 1:65921705-65921727 AACAAGCAGCAGGCTGGATTTGG + Intronic
908741640 1:67334841-67334863 AACAGGCAGAGGGCCAGATTTGG + Intronic
908941632 1:69441978-69442000 AACAGGCAGAGGGCTAGATTTGG - Intergenic
909407323 1:75305969-75305991 AACAGACAGCAAACCAGATTTGG - Intronic
909986526 1:82167428-82167450 AACAGGTAGTGGGCCAAATTTGG - Intergenic
910341571 1:86194146-86194168 AAGAGGCAGTGGGACAAATTTGG - Intergenic
911107592 1:94147807-94147829 AACAGGTGGCAGGCCTGATTTGG + Intergenic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911139625 1:94485083-94485105 AACAAGTAGCAGGCTAGATTTGG + Intronic
911226794 1:95315813-95315835 AACAGGCAGCAGGCTGGATTTGG + Intergenic
911519881 1:98916633-98916655 GATAGGCAGCAGATCAAATTTGG + Intronic
912199994 1:107445965-107445987 AACAGGAAGCAGGCTGGATTTGG + Intronic
913008922 1:114663621-114663643 AACAGGCAGTGGGCCAAATTTGG - Intronic
913303993 1:117404732-117404754 AACAGACAGCAAGCAGAATTTGG - Intronic
913326752 1:117634640-117634662 AACCAGCAGCAGGACAGATTTGG + Intergenic
913485690 1:119331083-119331105 AATAGGCAGCACGCCAGATTTGG + Intergenic
913549086 1:119898902-119898924 AACACCCAGCAGCCTAAATTGGG + Intergenic
914340662 1:146757143-146757165 AACAAGCAGCAGGACAGATTTGG + Intergenic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
914784896 1:150820046-150820068 AACAGGCAGTGGGCCTGATTTGG - Intronic
915691650 1:157696429-157696451 AGCAGGCAGAAGCCCAAAGTAGG + Intronic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
917283969 1:173405424-173405446 AACAGGCAGCAGGCTGGAATTGG + Intergenic
917323276 1:173806126-173806148 AACAAGCAGCAGATCAGATTTGG + Intronic
917584945 1:176416827-176416849 AAAAGGCAGCAGCCCCATTTAGG - Intergenic
917614414 1:176725276-176725298 AACAGGCAGTGGGTCAGATTTGG + Intronic
917622467 1:176810620-176810642 AACAGGCAGCAGACCAGACTGGG + Intronic
917648423 1:177051343-177051365 AACAGGCAGTGGGCCACATTTGG - Intronic
917697821 1:177545741-177545763 AACAGTTTGCAGGCCAGATTAGG + Intergenic
917900761 1:179540844-179540866 AAAAGGCAGCAGCCCAAGTCAGG - Intronic
918198705 1:182246953-182246975 AACAGGCAGTGGGCCAGATTTGG + Intergenic
918375564 1:183905764-183905786 AACAGGCAGTGGGCCACATATGG - Intronic
918675491 1:187279774-187279796 AACAAGTAGCTGGCCACATTTGG + Intergenic
919272777 1:195371334-195371356 AACAGACAACAAGCCAGATTTGG - Intergenic
919481308 1:198092947-198092969 TACAGGCAGCAGACAAGATTTGG + Intergenic
920152852 1:203923119-203923141 AACGAGCAGTAGGCAAAATTAGG + Intergenic
920353501 1:205353167-205353189 AACAGGCAGCAGGCCAGGGTTGG - Intronic
920897392 1:210068283-210068305 AAAAGACAGCATGACAAATTGGG - Intronic
920997008 1:211002982-211003004 AACAGGCCACTGGCAAAATTTGG - Intronic
921033889 1:211358022-211358044 AACAAGTAGCAGGCCAGATTTGG + Intronic
921258666 1:213365925-213365947 AACAGGTGGCAGGCCAGATTTGG + Intergenic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
921765615 1:218969978-218970000 AATAGACAGTAGTCCAAATTTGG - Intergenic
921871623 1:220146604-220146626 TACAGGCATCAGTTCAAATTTGG + Intronic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
922374689 1:224950702-224950724 AACAGGTGGCAGGTCAGATTTGG - Intronic
922463585 1:225830847-225830869 AACAGGTAGCAGGCTACATTTGG - Intronic
922635181 1:227161645-227161667 AACAGGCAGCAAACCAGATTTGG - Intronic
923367630 1:233278356-233278378 ATCAAGCAGCAGCCCAGATTGGG - Intronic
923562528 1:235052110-235052132 AACAGGCCACTGGCCAGATTTGG + Intergenic
923694947 1:236239262-236239284 AATAAGCAGCAGGCCAGATTTGG - Intronic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1063098936 10:2933089-2933111 AACAGCAAGCAGGCCAAACAAGG + Intergenic
1063442052 10:6080766-6080788 AACAGGAAGTGGGCCAGATTTGG + Intergenic
1063551008 10:7033241-7033263 AACAGGCTGCAGACAAAATATGG - Intergenic
1063890095 10:10620145-10620167 AACAGGTAGTGGGCCAAATTCGG - Intergenic
1064156180 10:12905223-12905245 AACAGGCAGGGGGCCAGATGTGG - Intronic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1064669837 10:17701444-17701466 AACAGGCAACAGGCTAAATTTGG - Intronic
1064757881 10:18588247-18588269 GACAGGCAGCAGGCCCACTCAGG + Intronic
1064797907 10:19034591-19034613 AACAGGACACAGGCCAAATTTGG + Intergenic
1064797908 10:19034604-19034626 TATGGGCTGCAGGCCAAATTTGG - Intergenic
1065119359 10:22513883-22513905 AAAAGGCAGCAGTCCCAGTTAGG - Intergenic
1065137070 10:22682050-22682072 AACAAGCAGCGGGCCAGATCTGG + Intronic
1067356606 10:45534264-45534286 AATAGGCAGCAGGCTAGATTTGG + Intronic
1067930101 10:50552079-50552101 AACAGGCAGAAGGCTGGATTTGG + Intronic
1068010458 10:51443188-51443210 TACAGTCTGCAGGCCAAATCTGG + Intronic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG + Intergenic
1068664328 10:59657262-59657284 AACCAGCAGTAGGCCAGATTTGG + Intronic
1068834007 10:61532207-61532229 AATAAGCAGCAGGCCAGACTTGG + Intergenic
1068867275 10:61907740-61907762 AACAGACAGTGGGCCAGATTTGG - Intronic
1068931487 10:62594848-62594870 AACTGACAGTAGGTCAAATTTGG + Intronic
1069061226 10:63896509-63896531 AATAGGCAGTAGGCCACATTTGG - Intergenic
1069296601 10:66853020-66853042 AACAGGTGGCAGGCCAGATTTGG - Intronic
1069337848 10:67374289-67374311 AACAGGTAGCCAGCCAGATTTGG + Intronic
1069669750 10:70191873-70191895 AACAGGCAGCAGGCTGGATTTGG + Intergenic
1069872532 10:71541963-71541985 GACAGGCAGTGGGCCAGATTTGG + Intronic
1069947816 10:71999683-71999705 AACAGGCCGCAGTCCATTTTGGG + Intronic
1070237175 10:74640765-74640787 AATAGGCAGCTAGCCAGATTTGG + Intronic
1070431971 10:76349351-76349373 AACAGGCAGTGGGCCAGATTTGG + Intronic
1070960534 10:80497368-80497390 AACAGGCGGAAGGCCAGGTTTGG - Intronic
1071190088 10:83089663-83089685 AAAAGGCAGCAGCCCCAATCAGG + Intergenic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1072329105 10:94328497-94328519 AACAGGTGGCAGGCTAGATTTGG + Exonic
1072463569 10:95642183-95642205 AACCAGCAGCATGCCAGATTTGG - Intronic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072791093 10:98318444-98318466 AACAGGCAGGAGGCCCAAGGTGG + Intergenic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1072952138 10:99857181-99857203 AACAGGTAGCAGGGCAAATTTGG - Intergenic
1073192468 10:101661526-101661548 AACTGGCAGCAAGCTAAAATTGG - Intronic
1073318524 10:102599791-102599813 AACAGACAGGAGGCCAGGTTGGG + Intronic
1073993766 10:109293080-109293102 AACAGGCAGTGGACCAAATTTGG - Intergenic
1074158649 10:110819379-110819401 AACAGGCTGTAGGTCAGATTCGG + Intronic
1074648487 10:115491401-115491423 AAAAGGCAGCAGCCCAAGTCAGG - Intronic
1074876150 10:117614839-117614861 AACAGGCAGCTGGAAAGATTTGG - Intergenic
1074922793 10:118034169-118034191 AACTGGCAGCAAGCCAGATTTGG + Intronic
1074982009 10:118627256-118627278 AACATGCAGCAGGGAAAACTTGG + Intergenic
1075038109 10:119086248-119086270 AACAGGCAGTAGACCAAATTTGG + Intergenic
1075229351 10:120660398-120660420 AACAGACAGCAAGTCAGATTTGG + Intergenic
1075358575 10:121807743-121807765 AACAAGCAGCAGACCAAATTTGG - Intronic
1075952953 10:126497843-126497865 AACAGGCAGCAGGCTGGACTCGG + Intronic
1075953138 10:126499059-126499081 TACAGACTGCAGGCCAAATCTGG + Intronic
1075953139 10:126499072-126499094 AACAAGCAGTGGGCCAGATTTGG - Intronic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1077596216 11:3533960-3533982 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1077765045 11:5149375-5149397 AACAGGAAGTAGGCCAGGTTTGG - Intergenic
1077952200 11:6972338-6972360 AACAGGTGACAGGCCAAATTTGG + Intronic
1078112839 11:8413091-8413113 AACAGATGGCATGCCAAATTTGG - Intronic
1078116576 11:8458435-8458457 AACAGGTAGCAGGCCCAATGTGG + Intronic
1078167271 11:8898612-8898634 AACAAGCAGTAGGCCATAATTGG - Intronic
1078336385 11:10466523-10466545 AAAAGGCAGCAGCCCCAATCAGG + Intronic
1078880579 11:15444986-15445008 AACAGGCAGCAGGGTGAATTTGG - Intergenic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1080313567 11:30923120-30923142 AACAGGCAGGGGACCAGATTTGG - Intronic
1080424191 11:32141140-32141162 AATAGGCAGTGGGCCAGATTTGG + Intergenic
1080479365 11:32630291-32630313 AACAGGCAGCAGGCTGCATTTGG - Intronic
1080868877 11:36219046-36219068 AACAGGTAGCAGGTCAGATTTGG - Intronic
1081347018 11:42000654-42000676 AACAGGCAGTGGGCCAGACTTGG - Intergenic
1081547327 11:44080806-44080828 AACAGGCAGCAGGCTATGTTTGG + Intronic
1082670736 11:56033608-56033630 AAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1083810318 11:65101291-65101313 TACAGCCTGCAGGCCAAATCTGG - Intronic
1084065716 11:66702984-66703006 AACAGGCAGCAGGCTGGATTTGG + Intronic
1084252124 11:67907940-67907962 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1084303620 11:68267146-68267168 AACAGGCAGCAGGTGGGATTCGG + Intronic
1084602333 11:70153351-70153373 AACAGACAGGGGGCCAGATTTGG + Intronic
1084682526 11:70674844-70674866 AACAGGCAATGGGCCAGATTTGG + Intronic
1085607437 11:77914747-77914769 AGCAGGCAACAGGCCAGCTTTGG + Intronic
1085797050 11:79551504-79551526 AACAGGTGGCAAGCCAGATTTGG + Intergenic
1085858433 11:80203334-80203356 CACAGGCAGCACAGCAAATTGGG - Intergenic
1086384302 11:86291340-86291362 AACAGACAGCTGGCCAGGTTCGG - Intergenic
1086486774 11:87312764-87312786 AACAAGTAGCAGGCCAGATTTGG + Intronic
1087283198 11:96235243-96235265 AACAGCCTGCAGGCCAGATTTGG - Intronic
1087879319 11:103396297-103396319 AACTAGCAGCAGGCTAGATTTGG - Intronic
1087912531 11:103770309-103770331 AACAGGTGGCAAGCCAGATTTGG - Intergenic
1087949183 11:104199201-104199223 AACAGGCACTGGGCCAAATTTGG + Intergenic
1088726544 11:112642173-112642195 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1088758332 11:112906005-112906027 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1089276374 11:117338812-117338834 AACAGGCAAGAGGCCAAGGTAGG - Intronic
1089425898 11:118374478-118374500 AACAGGTGGCAGGCCAGATTTGG - Intronic
1089951412 11:122531230-122531252 AACAGGTGGCAGGCTAGATTTGG + Intergenic
1090069671 11:123532637-123532659 CATAGCCAACAGGCCAAATTCGG + Intronic
1090373614 11:126273920-126273942 AACAGGCAGCAGGTCGGATTTGG + Intronic
1090523834 11:127507363-127507385 AGCAGGTAGCAGGCCAGATGTGG + Intergenic
1090647988 11:128781378-128781400 TACAAGCTGCAGGCCAAATCTGG + Intronic
1091486312 12:892414-892436 AACAGGCAGTAGGCTGAATTTGG + Intronic
1091733499 12:2899401-2899423 AACTGACGGCAGGCCAGATTTGG + Intronic
1091880635 12:3974654-3974676 AACAGGCAGCAGGCAGGATTAGG - Intergenic
1092262078 12:6958255-6958277 CACAGGCAGAGGGCCAAAGTGGG - Intronic
1092307027 12:7311658-7311680 AAAAGGTGGCAGGCCAGATTTGG - Intronic
1092422390 12:8342732-8342754 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1092491894 12:8953072-8953094 CACAGGCAGCAGGTCAAGTGAGG - Intronic
1093139421 12:15490566-15490588 AACAGGTGGCAGGGCAGATTTGG + Intronic
1093316114 12:17652170-17652192 ATTAAGCATCAGGCCAAATTTGG - Intergenic
1093440741 12:19192896-19192918 AACAGGCAGCAGGCTGGATTTGG - Intronic
1094281912 12:28749600-28749622 AACACGCAGCAGGCCATAATAGG + Intergenic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1094554566 12:31485600-31485622 AACAGTCAGCTGGACAGATTTGG + Intronic
1095156630 12:38864247-38864269 AACCAGCAGCAGGCCAGATTTGG - Intronic
1095254447 12:40018128-40018150 AACAGAAAGCCGGCCAGATTTGG - Intronic
1095454543 12:42369010-42369032 AACAGACAGCTGACCAGATTTGG - Intronic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1096371865 12:51075670-51075692 AACAGGCATTGGGCCAGATTTGG + Intronic
1096520823 12:52183636-52183658 ACCAGGCGGCAGGCCAAATGAGG + Intronic
1096744948 12:53720446-53720468 AACAGGTGGCAGGCTAGATTTGG + Intronic
1097372507 12:58801495-58801517 AAAAGGCAGCAGGCTAAGTATGG - Intronic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098115026 12:67166024-67166046 AATAGGCCACAGGCCAGATTTGG - Intergenic
1098276073 12:68812582-68812604 AACAGGTAACAGGCCAAAGTTGG - Intronic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1098513747 12:71349636-71349658 AACAGGTGACAGGCCAGATTTGG + Intronic
1098985049 12:77003071-77003093 AACAGGCTGCAGGCTAGATTTGG + Intergenic
1099055995 12:77841569-77841591 ACTGGGCACCAGGCCAAATTTGG - Intronic
1099126436 12:78764005-78764027 AATAGGCAGTGGGCCAAATTTGG + Intergenic
1099346506 12:81506893-81506915 AACAGGTAGCAGGCCAGATGTGG + Intronic
1099517875 12:83621307-83621329 AACAGGCAGTGGTCCAAATTTGG + Intergenic
1099646827 12:85367985-85368007 AACAGGCAGCAGGTTGGATTTGG + Intergenic
1099818483 12:87678733-87678755 AACAGGCAGTAGGCTAGATTTGG + Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1100512603 12:95291621-95291643 AACAGGCAGTGGGGCAGATTTGG + Intronic
1100746034 12:97646919-97646941 AGTAGGCTGCAGGCCAGATTTGG + Intergenic
1101014839 12:100489593-100489615 AACAGGCAGCCGACCGGATTTGG + Intronic
1101039560 12:100740682-100740704 AACAGGTAGCCAGCCAGATTTGG - Intronic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101208013 12:102508208-102508230 AACAGGCAATGGGCCAGATTTGG - Intergenic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1101814541 12:108135797-108135819 AACAGGCAGTGGGCCAGATTTGG - Intronic
1101844394 12:108350853-108350875 AACAGGCAGTGGGCCAAATCTGG - Intergenic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1102131510 12:110533550-110533572 AACATGAAGCAGGACATATTTGG - Exonic
1102590672 12:113954707-113954729 AACAGGCAGTGAGCCAGATTTGG - Intronic
1102600273 12:114024550-114024572 AACAGGTGGCAGGCCAGATCTGG + Intergenic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1102788442 12:115623297-115623319 AATAGGCAGCGTGTCAAATTTGG - Intergenic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103040354 12:117690103-117690125 AACAGGCTGTGGGCCAAGTTTGG + Intronic
1103045786 12:117733454-117733476 AACAGGTAGTGGGCCAGATTTGG - Intronic
1103048510 12:117759250-117759272 AACAGGTACCTGGCCCAATTTGG - Intronic
1103098865 12:118154963-118154985 ACCAGGCACCAGGCTAGATTTGG - Intronic
1103115237 12:118323046-118323068 AACAGGCAGCACAACAGATTTGG + Intronic
1103265775 12:119628964-119628986 AACAGGCAGCAGGCTGGATTTGG + Intronic
1103810323 12:123608424-123608446 GACAGGCAGCAGCCCAGGTTTGG + Intronic
1103849188 12:123920494-123920516 AACAGGCAGCAGGCTGGATTTGG + Intronic
1103849544 12:123923196-123923218 AGCAGGCAGTGGGCCAGATTTGG - Intronic
1103964137 12:124627351-124627373 ACCAGGCAACAGGCCAGATCTGG - Intergenic
1104051531 12:125197493-125197515 AACAAGTAGAGGGCCAAATTTGG - Intronic
1104083674 12:125456066-125456088 AACAAGTGGCAGGCCGAATTTGG + Intronic
1104578617 12:129991666-129991688 AACAGGCAACAGATCAGATTTGG + Intergenic
1105348167 13:19592492-19592514 AACAGGTGGCAGGCCAGGTTTGG - Intergenic
1105625976 13:22112985-22113007 TTCAGGCAGCAGGTCAAATCAGG - Intergenic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1106199208 13:27522514-27522536 AACAGACAACAGGCCAAGTGGGG + Intergenic
1106502275 13:30340413-30340435 AACAGGCAGCAGGCCAGTCCTGG + Intergenic
1107291764 13:38862725-38862747 AACAGGCAGCAGACTGTATTTGG - Intronic
1107480562 13:40782348-40782370 AACAGGTGGCAGGCCAGATTTGG - Intergenic
1107746216 13:43512693-43512715 GATAGGCAGCAGGTCAAATATGG - Intronic
1108293199 13:48983557-48983579 ACTAGGCAGCAGACCAGATTTGG + Intronic
1108339652 13:49485888-49485910 AACAGGTAGAGGGCCAGATTTGG - Intronic
1108524265 13:51272525-51272547 AATAGGTGGCAGGCCAGATTTGG - Intronic
1108743864 13:53369366-53369388 AACATGCAGAAGGCTAGATTTGG - Intergenic
1108912159 13:55568411-55568433 AACAGGCTGCAAACCAGATTTGG + Intergenic
1109286427 13:60414290-60414312 AACTGGTAGCAGGCCAGATTTGG - Intronic
1109559799 13:64031949-64031971 AAAAGGCAACAGTCCAAATGTGG + Intergenic
1110403420 13:75120956-75120978 AACAGGCAGGGGGCCAGATTTGG + Intergenic
1110444680 13:75565667-75565689 AAGAGGCAGTGGGCCAGATTTGG + Intronic
1110762512 13:79245938-79245960 CATAGGCAGGAAGCCAAATTTGG + Intergenic
1110967763 13:81722676-81722698 AACAGGCAGCAGGCTGGACTTGG - Intergenic
1111319867 13:86613339-86613361 AACAGGCAGTAGGAAAAAATTGG - Intergenic
1111364425 13:87223546-87223568 CATAGCCAGCAGGCCAAAGTGGG + Intergenic
1111436662 13:88219776-88219798 AACAGGCACCAGCCCAAATTGGG + Intergenic
1111818935 13:93190576-93190598 AAGAGGAAGCAAGCCAGATTTGG - Intergenic
1112759643 13:102679908-102679930 AACAGGCAGCAGTCCAGTTTGGG - Intronic
1113138052 13:107115657-107115679 AACAAGAAGCAGAACAAATTTGG - Intergenic
1113303405 13:109048567-109048589 AACAGGCAGTGGGCCATGTTTGG + Intronic
1113612276 13:111655617-111655639 AACAGGCAGTGGGCCAGAGTTGG + Intronic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1114325211 14:21582016-21582038 CACACGGGGCAGGCCAAATTTGG + Intergenic
1114769780 14:25415627-25415649 AACAGGCTGCAGGCAAATTAGGG + Intergenic
1114817219 14:25974438-25974460 AACAGATTGCAGGCCAGATTTGG + Intergenic
1115229512 14:31144670-31144692 AATGGGGAGCAGGCCAGATTTGG + Intronic
1115322493 14:32098733-32098755 AAAAGGCAGCAGGCTGGATTTGG + Intronic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1115523423 14:34255593-34255615 AACAGGCCACAGGCCCAATTTGG + Intronic
1116277360 14:42852760-42852782 AACTGGCAGCAGTCCAGATTTGG + Intergenic
1116338108 14:43685601-43685623 AACAGGTGGTAGGCCAGATTTGG - Intergenic
1116883358 14:50194141-50194163 AACAGGCTGCAGGCTGGATTTGG - Intronic
1116995471 14:51319293-51319315 AACAGTCAGCAAGCCAGATTAGG - Intergenic
1117673422 14:58131356-58131378 AACAAGTGGCAGGCCAGATTTGG + Intronic
1118079256 14:62339412-62339434 AAAAGGCAGGGGACCAAATTTGG - Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1118228542 14:63926588-63926610 AGCAAGCAGCAGGTCAAATTTGG + Intronic
1119112913 14:71991956-71991978 AACAGGCAGTGAGCCAGATTTGG + Intronic
1119362862 14:74066247-74066269 AACAGGCAGGAAGCCACATTTGG - Intronic
1119496929 14:75087829-75087851 AACAGGCAGTGGGCCAGAATTGG - Intronic
1119824212 14:77643533-77643555 AACAGGCAGCAAGCAGGATTTGG - Intergenic
1119914963 14:78390235-78390257 AATAGGTAGTGGGCCAAATTAGG - Intronic
1120093599 14:80362897-80362919 AACAGACAGTGGGCCATATTTGG - Intronic
1120435327 14:84474624-84474646 AATAGGTAGCAAGCAAAATTTGG - Intergenic
1120511305 14:85418702-85418724 AAGAGGCCGCAGGGCAGATTCGG + Intergenic
1120518262 14:85495464-85495486 AACAGGCAGTTGGCAGAATTTGG - Intergenic
1120614496 14:86686395-86686417 AATAAGCAGCAGGCCAGATTTGG - Intergenic
1120705521 14:87741297-87741319 AACAAGCAGCAGGCCAGACTTGG + Intergenic
1120740441 14:88103326-88103348 AACAGGTAGCAGGCTGCATTTGG - Intergenic
1120804290 14:88729380-88729402 AATAGGCAGCAGGCCTGGTTTGG - Intronic
1120959998 14:90115711-90115733 AACAGGCAACAGGCCGATCTAGG + Intronic
1121134551 14:91484389-91484411 AACAGGTGGCAGACCAAATTTGG - Intronic
1121182627 14:91941061-91941083 AACAGGGAGCATGCCACATTAGG - Intronic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121478668 14:94239585-94239607 AACAGGCGGTGGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1121659139 14:95621727-95621749 AACAGGCAGACAGCTAAATTTGG + Intergenic
1121720095 14:96103250-96103272 AACAGGCAGTGGGCCAGACTTGG - Intergenic
1121830577 14:97048175-97048197 AGCAGGTAGCAGGTCAGATTTGG - Intergenic
1121950826 14:98169841-98169863 AAGAGGCATCAGTGCAAATTAGG + Intergenic
1122321406 14:100858139-100858161 ACCAGGCAGGAGGCCTTATTTGG - Intergenic
1122621712 14:103061678-103061700 AACAAGCAGCAGGCTAAATTTGG + Intergenic
1123725319 15:23095752-23095774 AACAGGCAACAAGCCTAATATGG + Intergenic
1123908715 15:24945566-24945588 TACAGGCAGCAGGCAGGATTTGG + Intronic
1124425725 15:29560887-29560909 CAAAAGCAGCAGGCCAGATTTGG - Intronic
1124826418 15:33100456-33100478 AACAGGCAGTAGGCTGTATTTGG - Intronic
1125310264 15:38371512-38371534 AACAGGTGGCAGGCAAGATTTGG - Intergenic
1125621300 15:41065145-41065167 AACAGGTAGCAGGCCAGGCTCGG + Intronic
1125635865 15:41188238-41188260 AACAGTCTGCAGGCCAGATTTGG + Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125829979 15:42708315-42708337 AACAGGAAGCAGGCCAGATCTGG - Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1125894539 15:43291603-43291625 AACAGGCAGTAGGCCACATTTGG + Intronic
1126196590 15:45938274-45938296 AACAGGCAGCAGATCAGATGTGG - Intergenic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126666554 15:51080760-51080782 AACAGGTGGCAGGCCAGATTTGG + Intronic
1126748785 15:51854318-51854340 GACAGGCAGCAGGCCGAATTTGG + Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1127204564 15:56700703-56700725 AACAGGCAGTATGCCTAAATAGG - Intronic
1127760249 15:62132530-62132552 AACAGGAAGCAGGTCAGATTTGG + Intergenic
1127885384 15:63194757-63194779 AACAGGCTGCAGGTCACACTTGG - Intronic
1128105337 15:65040262-65040284 ACCAGGCTGCAGGTCAGATTTGG + Intergenic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128190906 15:65695480-65695502 AATAGGCTTCAGGGCAAATTTGG + Intronic
1128343631 15:66840118-66840140 AATAGGTGGCAGGCCAGATTTGG - Intergenic
1128777946 15:70338021-70338043 AGCAGCAAACAGGCCAAATTTGG - Intergenic
1128795282 15:70462146-70462168 AATAGGCAGTGGGCCAGATTTGG - Intergenic
1128928992 15:71686861-71686883 AGCAGGTGGCAGGCCATATTTGG + Intronic
1128973519 15:72130481-72130503 AGCAGGCAGTGGGCCAGATTTGG + Intronic
1128994059 15:72283922-72283944 AATAGGCCACAGGCCAGATTTGG + Intronic
1129557514 15:76528174-76528196 AACAGGCAGTGGGCCAGATTTGG + Intronic
1129952745 15:79606515-79606537 AATAGGCAGCAGGCCCATTTTGG - Intergenic
1130146033 15:81274221-81274243 AACAGGCGGTGGGCCAGATTTGG - Intronic
1130393073 15:83476513-83476535 AACAGGCAGTGGGCCATATCTGG - Intronic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1130762738 15:86837397-86837419 TACAGCCTCCAGGCCAAATTTGG + Intronic
1130888547 15:88113673-88113695 AACAGGTGCCAGGCCAGATTTGG - Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1131771687 15:95744775-95744797 AACAGGCTGCAGGCTGAATTTGG + Intergenic
1133142998 16:3761928-3761950 AGCAAGCAGCTGGCCACATTTGG - Intronic
1133375891 16:5286867-5286889 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1133540228 16:6744853-6744875 AACAGGTAGTAGGCCAAAAATGG + Intronic
1133608095 16:7407849-7407871 AATAGTCCGCAGGCCAGATTAGG - Intronic
1134147813 16:11781310-11781332 AAAGGACAGCAGGCCAGATTGGG + Intronic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134397177 16:13875761-13875783 AACAAGCAGCGGGCCAGATCTGG - Intergenic
1134518524 16:14906340-14906362 AACAGACAGCTGGCCAGAGTTGG - Intronic
1134555406 16:15159877-15159899 AACAGACAGCAGGCCAGAGTTGG + Intergenic
1134649517 16:15897563-15897585 AACAGGCAGGCGGCCAGATGCGG - Intergenic
1134660776 16:15982858-15982880 AGCAGGCAGCAGGCTGAATTTGG + Intronic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134690092 16:16185272-16185294 AAAAGGCAGCAGGCAGGATTTGG - Intronic
1134694574 16:16214008-16214030 AACAGGCAGTGGGCCAGATTTGG - Intronic
1134706195 16:16304993-16305015 AACAGACAGCTGGCCAGAGTTGG - Intergenic
1134756161 16:16669492-16669514 AACAGGTAGTGGGCCAGATTTGG + Intergenic
1134961345 16:18407117-18407139 AACAGACAGCTGGCCAGAGTTGG + Intergenic
1134965645 16:18489720-18489742 AACAGACAGCTGGCCAGAGTTGG + Intronic
1134977261 16:18580629-18580651 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1134989907 16:18689672-18689694 AACAGGTAGTGGGCCAGATTTGG - Intergenic
1135151144 16:20007097-20007119 AACAGACAGTGGGCCAGATTTGG - Intergenic
1135595785 16:23741863-23741885 AACAGGCAGCAGGCAGGGTTTGG - Intergenic
1135633334 16:24053449-24053471 AACAGGCAGGAGGCTGGATTTGG + Intronic
1135720010 16:24808374-24808396 AGCAGGCAGTGGGCCAAATTTGG - Intronic
1135760631 16:25135358-25135380 AACAGGCTGTGGGCCAGATTTGG - Intronic
1135830900 16:25772104-25772126 ACAAGGCAGCAGGCTAGATTTGG + Intronic
1135835032 16:25817507-25817529 AATAGGCAGCAAGCCATATTTGG + Intronic
1135961368 16:26997063-26997085 AGCAGGCAGCAGGTCAGATGAGG + Intergenic
1136001967 16:27301602-27301624 AACACGCAGTGGGCCAGATTTGG + Intergenic
1136090194 16:27913563-27913585 AACAGGAGGCATGGCAAATTTGG - Intronic
1138278610 16:55755399-55755421 AAAAGACAGTAGGCCAGATTTGG - Intergenic
1138289945 16:55838222-55838244 AAAAGACAGTAGGCCAGATTTGG + Intergenic
1138754850 16:59471056-59471078 AACAAGTGGTAGGCCAAATTTGG - Intergenic
1139048325 16:63090848-63090870 AACAGGCAGTAGACCAAATTTGG - Intergenic
1139206705 16:65035947-65035969 AGCAGACAGAAAGCCAAATTGGG - Intronic
1139780463 16:69347275-69347297 AACAGGCAATGGGCCAGATTTGG + Intronic
1139993623 16:70960263-70960285 AACAAGCAGCAGGACAGATTTGG - Intronic
1140261495 16:73384166-73384188 AACAGGGTGCAGGCCAGATTTGG - Intergenic
1140761549 16:78113475-78113497 AACAGGCAGTGGGCCAGATTTGG + Intronic
1140799538 16:78472960-78472982 AACAGGCTGCAGATCAGATTTGG - Intronic
1140976868 16:80068301-80068323 AACAGGTGGTAGGCCACATTTGG + Intergenic
1141063103 16:80893077-80893099 ACCAGGCAGCAGGCTGGATTTGG + Intergenic
1141092021 16:81136950-81136972 AACAGGCAGCAGGAGACATGTGG + Intergenic
1141247661 16:82325073-82325095 AATAGGCAGCAGGACAGATCTGG + Intergenic
1141536607 16:84685565-84685587 AACAGGTAGAGGGCCAGATTTGG + Intergenic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1142747135 17:1965552-1965574 AGCAGGAAGCAGGCCAGAGTGGG + Intronic
1142897012 17:2987144-2987166 CACAGGCAGCAGGCCAGACTTGG + Intronic
1143379274 17:6485827-6485849 AACAGGCAGTGGGGCAGATTTGG - Intronic
1143753987 17:9053079-9053101 AACAGGCAACAGACAGAATTTGG - Intronic
1143823039 17:9580146-9580168 AACAGGCAGTGGGCCAGATTTGG - Intronic
1144294601 17:13861639-13861661 ATCAGGCTACAGGCCAGATTTGG + Intergenic
1145986116 17:29047748-29047770 AACAAGCAGAAGGCCAGATTTGG + Intronic
1146113531 17:30113389-30113411 ACCAGGCAGCTGGCCAGATTTGG - Intergenic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1146528455 17:33587053-33587075 AACAGGCAACAGGCTGGATTTGG - Intronic
1146640819 17:34540100-34540122 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1146831608 17:36074315-36074337 AACAGGTAGTAGGTCAAATTGGG - Intergenic
1147694601 17:42341878-42341900 AACAAGCAGCAGGCTGGATTTGG + Intronic
1148033980 17:44644161-44644183 AACAGGTGGTAGGCCAGATTTGG + Intergenic
1148787047 17:50150563-50150585 AACAGGCGGCTGGCCAAGTCGGG + Exonic
1148978798 17:51553114-51553136 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1148983072 17:51596038-51596060 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1149030282 17:52074808-52074830 AACAGGCAATGGGCCATATTTGG - Intronic
1149158333 17:53661156-53661178 AACAAACGGCAGGCCAGATTTGG + Intergenic
1149281547 17:55110749-55110771 AATAGGCGGCAGTCCAGATTTGG + Intronic
1149413132 17:56429565-56429587 GACAGGCAGCAGGCTGGATTTGG + Intronic
1149573409 17:57693875-57693897 AATAGGCAACAGGCCTGATTTGG - Intergenic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1149818678 17:59752274-59752296 AACAGGTAGCAGGCTGGATTTGG + Intronic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150056931 17:62025703-62025725 AACAGGCAGTGGGCCAAATATGG + Intronic
1150161913 17:62905757-62905779 AAAAGGTGGCAGGCCAGATTTGG + Intergenic
1150175682 17:63052973-63052995 AATAGGTGGCAGGCCAGATTTGG + Intronic
1150192746 17:63260425-63260447 AACAGGTAGCAGGCCATATTTGG + Intronic
1150926594 17:69538986-69539008 AACAAGCAGTGGGCTAAATTTGG + Intronic
1150997157 17:70331771-70331793 AACCGACAGCAGGTCAGATTTGG - Intergenic
1151142096 17:72003432-72003454 AACAGGCTGCGGGCCTAATTTGG + Intergenic
1151229376 17:72672560-72672582 AACAGGAGGTAGGCCATATTTGG - Intronic
1151669968 17:75566625-75566647 AATAGGCAGGAGGCCAGATTTGG + Intronic
1151710174 17:75800023-75800045 AGCAGGCAGCAGGCTGGATTTGG - Intronic
1152117361 17:78396685-78396707 AACAGGTGGCAGGCCACAGTCGG - Intronic
1152150477 17:78597077-78597099 AACAGGCAGAGGGCTAGATTTGG + Intergenic
1152432215 17:80254796-80254818 AAGAGGCAGCAGTTCACATTTGG + Intergenic
1152507561 17:80760624-80760646 AACAGGCAGTTGGCCAGATTTGG + Intronic
1153033590 18:737664-737686 AACAGGCTGCAGGCCACTTTTGG - Intronic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1153397374 18:4639889-4639911 AACAGCCAAGAAGCCAAATTTGG + Intergenic
1153443461 18:5146841-5146863 AACAGACCACAGGCCAGATTTGG + Intronic
1154046344 18:10908975-10908997 AACAGGCAGCAGGCAGGATTTGG - Intronic
1154458114 18:14549196-14549218 AAGTGGCAGCAGGCTAGATTTGG - Intergenic
1154507013 18:15051612-15051634 AACAGGAAGCAAGCTAGATTTGG + Intergenic
1155080561 18:22406311-22406333 AACAGGCAGCAACCCCAGTTAGG + Intergenic
1155087897 18:22475413-22475435 AGTAGGCAACAGGCCATATTTGG - Intergenic
1155833043 18:30542298-30542320 AACAGGCTGCAGGCTGAATTTGG - Intergenic
1155901097 18:31391634-31391656 AACAGACAGCAAGCCAGATTTGG - Intronic
1156086496 18:33411424-33411446 AAAAGGCTGCTGGCCAGATTTGG + Intronic
1156210345 18:34933337-34933359 TACAGGCAGAAGGGGAAATTGGG + Intergenic
1156412233 18:36841745-36841767 AACAGCCAGTGGGCCAGATTCGG + Intronic
1156753467 18:40490740-40490762 AACTGACAGCCGGCCAGATTTGG + Intergenic
1156877066 18:42027591-42027613 AACAGGCAACAGGCTGAATTTGG - Intronic
1156904569 18:42337730-42337752 AACAGGCAACAGGCAGAGTTTGG - Intergenic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157098072 18:44705106-44705128 AACAGGCAGGAGGCTGGATTTGG - Intronic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157419117 18:47530798-47530820 CACAGTAAGCAGGCCAATTTTGG - Intergenic
1157534088 18:48445829-48445851 AACAGGCAACGGACCAGATTTGG + Intergenic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1157938348 18:51897867-51897889 AACAGGCAACTGGCCCGATTTGG + Intergenic
1157995336 18:52547970-52547992 AACAGGCAGTAGGCTGGATTTGG + Intronic
1158011878 18:52737978-52738000 AACAGGCAGAGGGCCAAAGTTGG - Intronic
1158210633 18:55045643-55045665 AACAGGCAGCAGATCAGATTTGG - Intergenic
1158947847 18:62463457-62463479 AACAGGCAGCTGGCCTGATTTGG + Intergenic
1159043855 18:63349766-63349788 AACAGGCAGAGGGCCAGATCTGG - Intronic
1159049856 18:63410167-63410189 AACAGGCAGCTGGGCAGCTTTGG + Intronic
1159193019 18:65072828-65072850 AACAGGGAGCAGGCTGGATTTGG - Intergenic
1160098611 18:75899851-75899873 ACCAGGCAGTAGGCCAGATTTGG - Intergenic
1161743992 19:6043522-6043544 AACAGGCAGTGGGCCAGATTTGG - Intronic
1162084200 19:8238596-8238618 AGCAGGCACCAGGCCAGAGTTGG + Intronic
1162595587 19:11626509-11626531 AACAGGCGGCAGTCCAAACACGG - Intergenic
1162882585 19:13671085-13671107 AACAGGCAGCCAACCAAATTTGG + Intergenic
1162905687 19:13822321-13822343 AACAGGTGGTTGGCCAAATTAGG - Intronic
1163065523 19:14790337-14790359 AACAAGCAGCAGGGTGAATTTGG + Intergenic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1163472174 19:17504110-17504132 AACAGGTGGAGGGCCAAATTTGG + Intronic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1165441078 19:35828197-35828219 AGCAGGTGGCAGGCCATATTTGG - Intronic
1166320061 19:42012132-42012154 AATAGACAGCAGGTCAGATTTGG - Intronic
1166527545 19:43522048-43522070 AACTGATGGCAGGCCAAATTTGG - Intronic
1166540356 19:43601138-43601160 ACCAGGCAGCAGGCTAGAGTTGG - Exonic
1166563993 19:43752434-43752456 AACAGAAAGCAGACCAGATTTGG - Intronic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1167974080 19:53209960-53209982 AAAAGGCAGCAGCCCCAATCAGG - Intergenic
1168366247 19:55790405-55790427 ACCAGGCAGAGGGCCAGATTTGG + Intronic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
925354945 2:3234069-3234091 AGCAGGCAGCAGGCTGGATTAGG + Intronic
925394550 2:3523544-3523566 AACAGGCAGCAGACTGAATCTGG + Intergenic
925737196 2:6973762-6973784 AACAGGCAGCAGGCTGGATTTGG - Intronic
926009596 2:9397632-9397654 AACAGGCAGCAGGCTGGATGTGG - Intronic
926620527 2:15043020-15043042 AACAGGCAGTAGGTCACATTTGG + Intergenic
927566882 2:24121355-24121377 AACAGGTAGTGGGCTAAATTTGG - Intronic
928002046 2:27532206-27532228 AACAGGCAGCATGCTGGATTTGG + Intergenic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
928243475 2:29606628-29606650 AACAGGCAATGGGCCAGATTAGG - Intronic
928470930 2:31574846-31574868 AACAAGCAGTGGGCCATATTTGG - Intronic
928649866 2:33392615-33392637 AATAGGTAGCAGGCCAGATTTGG + Intronic
928983888 2:37161814-37161836 AACAGGCAGCAGCCCAGTTTTGG - Intergenic
929031958 2:37657635-37657657 AACAGGCAGGGGGCCGGATTTGG - Intronic
929093865 2:38245747-38245769 TACAGGCTCCAAGCCAAATTCGG + Intergenic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929209879 2:39344290-39344312 ATCAGGCAGCAGGCTAGATTTGG - Intronic
929258297 2:39838238-39838260 CACAGGCACCAGGCCTAATGAGG + Intergenic
929525508 2:42699157-42699179 AACAAGCAGTAGGTCAGATTTGG - Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
930022568 2:47010344-47010366 AATAGGCAGAGGGCCAGATTTGG + Intronic
930163439 2:48180795-48180817 AGCAGGCAGCAGGCTGAATTTGG - Intergenic
930241494 2:48940170-48940192 AACAGGTAGTAGACCAGATTTGG + Intergenic
930261406 2:49150854-49150876 AACATGGGGCAAGCCAAATTTGG - Intronic
930516097 2:52409805-52409827 AAAAGGCAGCAGCCCCAGTTCGG - Intergenic
930875907 2:56215808-56215830 AACAGGCAACAGGCTAAATGTGG - Intronic
930895732 2:56443781-56443803 AACAGGGAGTGGGCCCAATTTGG + Intergenic
931119926 2:59205086-59205108 AACAGGCATCAGGTCTGATTTGG + Intergenic
931635307 2:64335596-64335618 AACAGGAAGAAGGCCAGATTTGG + Intergenic
932062686 2:68524426-68524448 ACCAGGCAGTGGGCCTAATTTGG - Intronic
932064789 2:68543358-68543380 AAAAAGCAGTAGGCCAGATTTGG + Intronic
932417416 2:71581824-71581846 AGCAGGCAGAGGGCCAGATTTGG - Intronic
932429293 2:71664383-71664405 AACAGGCTGCTGTCCAAGTTTGG + Exonic
932529839 2:72517336-72517358 AACAGGCAACAGGCTGGATTTGG + Intronic
932752971 2:74383706-74383728 AAGAGGCAGCAGGCCTACATGGG + Intronic
932806738 2:74791060-74791082 AACAGGCAGCAGGCTGGATTTGG + Intergenic
932848153 2:75155900-75155922 AATAGGCAGCAGGCCAGCTTTGG - Intronic
932858425 2:75263459-75263481 AACAGGTGGCAGGCCAGGTTTGG - Intergenic
933026474 2:77266014-77266036 ATCAGGTGGCAGACCAAATTTGG - Intronic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933462523 2:82607175-82607197 AACAGGCAACAAGCTAGATTTGG - Intergenic
933979036 2:87535719-87535741 AACAGGCAGAGGGCCAGATTTGG + Intergenic
934479223 2:94619409-94619431 ACAAGGAAGTAGGCCAAATTGGG - Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
934862672 2:97777417-97777439 AACAGACTGCAGGCCAGATTTGG - Intronic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
936314791 2:111415073-111415095 AACAGGCAGAGGGCCAGATTTGG - Intergenic
937636342 2:124159454-124159476 AATAGGTGGCAGGCCAGATTTGG + Intronic
938096190 2:128465707-128465729 ATCAGGCAGCAGGACAGATGAGG - Intergenic
938748261 2:134302196-134302218 AACAGGCAGTGGGCCAGATTTGG + Intronic
939055290 2:137358098-137358120 AAGAGGCAGCATGTCAAGTTTGG - Intronic
939259345 2:139787140-139787162 AACAGGCAGCATGCCCGATTTGG - Intergenic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
939611847 2:144320585-144320607 GACATGGAGCAGGCCAAAGTTGG - Intronic
939734032 2:145821053-145821075 AATAGGCAGCAGTCAAGATTTGG - Intergenic
940176852 2:150887188-150887210 AACAGGCAGGAGGGCAAACAGGG + Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940612335 2:156006947-156006969 AGCAGGCAGCAGTCCAAGCTGGG - Intergenic
940756857 2:157693184-157693206 AACAGACAGTGGGCCATATTTGG + Intergenic
940807335 2:158202815-158202837 AACAGGCAGAGGGCCAGATATGG + Intronic
940996990 2:160160063-160160085 AACAAGCAACAGGCCAAATATGG - Intronic
941494957 2:166188399-166188421 TGCAAGCACCAGGCCAAATTAGG + Intergenic
941677483 2:168359241-168359263 AACAGACAGCAAGCCAGATTAGG - Intergenic
941996850 2:171609323-171609345 AACAGGCAGTGGGCTGAATTTGG + Intergenic
942040732 2:172059675-172059697 AACAGTCAGCAGTCCAGATTTGG + Intronic
942866443 2:180681290-180681312 AACAGATAGCAGGCAAAATTTGG - Intergenic
942936745 2:181566382-181566404 AACAGGCACCAGGACAAATTGGG - Intronic
942994373 2:182243476-182243498 AACAGGAAGGAGGCCAAATGTGG + Intronic
943626319 2:190205036-190205058 AACAGGCAGCAGGCTGGATTTGG + Exonic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
944184980 2:196937883-196937905 AACATGCTGTAGGCCAGATTTGG + Intergenic
944487580 2:200223006-200223028 AACAGGCAGCGGGCCAGGTTTGG + Intergenic
944612362 2:201424561-201424583 AACAGGTGGCAAGCCAAATTTGG - Intronic
945138003 2:206650482-206650504 AACAGGGAGCAAGCCGAATTTGG + Intergenic
945712196 2:213312022-213312044 ATCAGGAAGCAGGCCAGATTTGG - Intronic
946350703 2:219149913-219149935 AACAGGCAGCAAGCCAGAATTGG + Intronic
946600402 2:221353925-221353947 CACAGGCTGAAGGCCAGATTTGG - Intergenic
946626373 2:221615858-221615880 AACAGGCTGTGGGCCAGATTTGG + Intergenic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947111893 2:226727455-226727477 AACAGGCAGCAGGCTGGATTTGG + Intergenic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
947249182 2:228082112-228082134 AACAGGCAGTGGCCCAGATTTGG + Intronic
947699787 2:232223074-232223096 AACACACAACAGTCCAAATTCGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
948275859 2:236708126-236708148 AACAGCCAGTGGGCCAGATTTGG + Intergenic
948412881 2:237778379-237778401 CACAGGCAGCAGGGCAGAGTGGG - Intronic
948882660 2:240868360-240868382 AGCAGGTGGCAGGCCAGATTGGG - Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169034090 20:2435623-2435645 AACAGGTGGCAGGCCAAGTTTGG + Intergenic
1169104018 20:2978844-2978866 AACAGGCAGTGGGCTAAATTTGG + Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169175652 20:3510436-3510458 AGCAGACAGCAGGCCTGATTTGG + Intronic
1169672867 20:8123607-8123629 AACAGGTAGCAGGCTGGATTTGG - Intergenic
1169809030 20:9590387-9590409 AACAGGCAGAGGGCCAGATTTGG - Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1170067743 20:12332683-12332705 AACAGGCAGCATCCCAGACTTGG - Intergenic
1170092949 20:12612523-12612545 AAGAGGCAGCAGGCCAGGTTTGG - Intergenic
1170108135 20:12774383-12774405 AATAGGCTGCAGGCCAGATATGG + Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1170497286 20:16938426-16938448 AACAGGAAGTGGGCCAGATTTGG - Intergenic
1170621555 20:18000593-18000615 ATCAGGCAGCAAGCCGGATTTGG - Intronic
1170853345 20:20023982-20024004 AACAGGCAGTGGGCCAGATTTGG - Intronic
1171040913 20:21762807-21762829 AACAAGCAGCAGGCTGGATTTGG - Intergenic
1171177479 20:23063521-23063543 AACAGGCAGTGGGCCAGAGTGGG + Intergenic
1171568523 20:26220980-26221002 CACAGGCAGCAGACCAGATCTGG + Intergenic
1172343763 20:34180334-34180356 ATCAGCAAGCAGGCCAAATCTGG + Intergenic
1172512161 20:35508278-35508300 AACAGGCAGCAGGCTGGATTTGG - Intronic
1172972628 20:38884556-38884578 AACAGGCTGCCTGCCAGATTTGG + Intronic
1173058795 20:39642245-39642267 AACAGGCAGTAGACTGAATTTGG - Intergenic
1173080220 20:39859629-39859651 AGCAGGCAGTGAGCCAAATTTGG + Intergenic
1173102752 20:40102790-40102812 AACAGGAAGCAGGCTGGATTTGG + Intergenic
1173150674 20:40564159-40564181 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1173159623 20:40642808-40642830 AAAAGGCAGTAGGCCACATTTGG + Intergenic
1173299832 20:41792405-41792427 AACTGGTGGCAGGCCAGATTTGG + Intergenic
1173325367 20:42027979-42028001 ATCAGGCAGAGGGCCAGATTTGG + Intergenic
1173415518 20:42851801-42851823 AACAAGCAGCAAACCAGATTTGG + Intronic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173454850 20:43193611-43193633 AACAGGCAGTGGGCCAGATGTGG - Intergenic
1173877413 20:46383009-46383031 AACAGGCAACAGGCCTAATATGG - Intronic
1173953165 20:47009054-47009076 AACAGGCAGTGGACCAGATTTGG + Intronic
1173969626 20:47142197-47142219 AACAAGCAGCAGGCCAGGTATGG + Intronic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1174190053 20:48734217-48734239 AACAGGCAGAGGGCCAGATTAGG - Intronic
1174219767 20:48944833-48944855 AGCAGACAGTAGGCCAGATTTGG - Intronic
1174543732 20:51309289-51309311 AACAGGCAGTGGGCCATATTTGG - Intergenic
1174645601 20:52082713-52082735 AACAGGTGGCAGGCTAGATTTGG - Intronic
1174675068 20:52345705-52345727 CACAGGAAGCAGGCTAGATTTGG + Intergenic
1174749070 20:53094042-53094064 AAAAGGCGGAGGGCCAAATTTGG - Intronic
1174763004 20:53225126-53225148 AACAGGCAGTGGGTCAGATTTGG + Intronic
1174785183 20:53425863-53425885 AACAGGTAGCAGGCTGAATTTGG + Intronic
1174792906 20:53497130-53497152 AACAAGTAGCAGGCCAAATTTGG + Intergenic
1174911432 20:54612198-54612220 AACAGTCAGCAGGCTGGATTTGG + Intronic
1174937889 20:54892520-54892542 AACAGGCAGCAGACCTAATTCGG - Intergenic
1174959477 20:55139035-55139057 AACAGGCAGTAGACTAATTTTGG + Intergenic
1174990116 20:55500216-55500238 AAAAGGCAGCAGCCCCAGTTAGG - Intergenic
1174999845 20:55615419-55615441 AACAGGCAGTGGGCTGAATTTGG - Intergenic
1175003136 20:55651967-55651989 AACAGGCAGCAGACTCAACTTGG + Intergenic
1175095262 20:56536017-56536039 AACAGGTGGAGGGCCAAATTTGG + Intronic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175292749 20:57888959-57888981 AACATGAAGCACGCCAAATAAGG - Intergenic
1175435198 20:58942092-58942114 AACAGGTGGCAGGCCAGATTTGG + Intergenic
1175451002 20:59068019-59068041 AACAGAGAGCTGGCCAGATTTGG - Intergenic
1175581459 20:60102987-60103009 ATCAGGCAGTGGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1175808501 20:61844926-61844948 TACAGGCAGCACTCCAACTTTGG + Intronic
1176790861 21:13317485-13317507 AACAGGAAGCAAGCTAGATTTGG - Intergenic
1176816042 21:13604108-13604130 AAGTGGCAGCAGGCTAGATTTGG + Intergenic
1177310109 21:19379678-19379700 AACAGGCTGTAGGCTAGATTTGG - Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177535446 21:22421380-22421402 GACAGGTAGCAAGCCAGATTTGG - Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177865854 21:26512543-26512565 AACAGGCAGCAGACCAGATCTGG - Intronic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1177990928 21:28035883-28035905 AACAGGAAGCAAGCTAGATTTGG + Intergenic
1178089593 21:29148647-29148669 AGCAGGCAGCAACCCAAATGGGG - Intronic
1178329117 21:31671862-31671884 AACAGGCAGCAGTTCAATTCAGG - Exonic
1178537432 21:33421882-33421904 TACAGCCTGCAGGCCAAATCGGG + Intronic
1178573099 21:33759229-33759251 AACAGGCAGTGGGCCAGATCTGG + Intronic
1178604023 21:34019535-34019557 AACAGGCAATGGGCCAGATTTGG - Intergenic
1178614735 21:34122265-34122287 TACAGGTAGCAAGCCAGATTTGG + Intronic
1178891824 21:36526308-36526330 AACAGGCAGCAGGGCAGGTTTGG + Intronic
1178926211 21:36777406-36777428 AACTGGCAGCAGGCCAGACTCGG + Intronic
1179177255 21:39017539-39017561 AAGAGGCGGCAGGCTAGATTCGG + Intergenic
1179182051 21:39053889-39053911 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179411140 21:41164260-41164282 AACAGGCAGTTGGCCAGATTTGG + Intergenic
1179415490 21:41195081-41195103 AACAGGTAGCTGGCCAGATTTGG - Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1179943873 21:44657506-44657528 AACAGGCAGTGGGCCAAATGTGG + Intronic
1180282400 22:10714663-10714685 AACAGGCAGAAGACCAGATCTGG - Intergenic
1180608650 22:17081288-17081310 AACAGGCAGTAGAACAGATTTGG - Intergenic
1181914006 22:26264747-26264769 AACAGGAGGAAAGCCAAATTTGG + Intronic
1182010018 22:26992851-26992873 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1183026740 22:35070996-35071018 AACAGGGGTCAGGCCAGATTTGG + Intronic
1183231588 22:36585509-36585531 ACCAGGCAGCAGGCTTCATTTGG - Intronic
1183755051 22:39754220-39754242 AACAGGCAGTGAGCCAGATTTGG + Intronic
1184621759 22:45684413-45684435 AACAGGTAGTAGGCCAGATCTGG - Intronic
1185276369 22:49951700-49951722 GCCAGGCCCCAGGCCAAATTTGG - Intergenic
949121661 3:391955-391977 AACAGGCAGCAGGCTGAATTTGG - Intronic
949168991 3:976232-976254 AACAGGCGGCCTGCCAAATTTGG + Intergenic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
950159380 3:10748249-10748271 AACAGGCAGTGGGCCAGATTTGG + Intergenic
950190946 3:10975727-10975749 AACAGGTAGTAGGCAGAATTTGG + Intergenic
950193038 3:10991574-10991596 AGCAGGGAGGAGGCCAGATTAGG + Intergenic
950434554 3:12970980-12971002 AACAGGCAGCAGGCTGGACTTGG - Intronic
951035243 3:17925555-17925577 AACAGGGAGGAGGCAAAATTTGG + Intronic
951055850 3:18145566-18145588 AACAGGCAGCAGGCCCCGTTTGG - Intronic
951072002 3:18339946-18339968 AACAAGTGGCAGGCCAAATTGGG + Intronic
951106910 3:18755055-18755077 AACAGGCAGTAGGCCATATTTGG - Intergenic
951258180 3:20475373-20475395 AACTGTCAGCAGACCAGATTAGG + Intergenic
951341381 3:21491624-21491646 AACAGGCAGCAAGCCTACTTTGG - Intronic
951571576 3:24069215-24069237 AACAGGTGGCGGGCCAGATTTGG - Intergenic
951587114 3:24226777-24226799 AACAGGCAGCAGGTCAGCTTTGG - Intronic
951615701 3:24541137-24541159 AACAGGCAGTGGGCCAGGTTTGG + Intergenic
951634587 3:24759164-24759186 AACAGGTGGCAGACCAGATTTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951801520 3:26601890-26601912 AACAAGCAGCAGGCAATATTTGG - Intergenic
951857237 3:27211362-27211384 AACAGGCAGCAGAATAAATATGG + Intronic
951883378 3:27501155-27501177 AACAGGCAGCTGGTCAGTTTTGG - Intergenic
951983588 3:28592975-28592997 AACAGGCATTAGGACCAATTTGG + Intergenic
952037389 3:29219453-29219475 AACAGGTGGCAGGCCAGATTTGG + Intergenic
952095643 3:29949434-29949456 AATAGGCAGCAAGCAGAATTTGG + Intronic
952109194 3:30103271-30103293 AATAGGCAGTGGACCAAATTTGG - Intergenic
952240215 3:31524488-31524510 AACAGGCAGCAAACCAGATTCGG - Intergenic
952326048 3:32321573-32321595 AACAGGCAGCAGGCATGATCTGG - Intronic
952337075 3:32413042-32413064 AACAGGTGGCAGGCCAGATTTGG - Intronic
952353629 3:32564380-32564402 AACAGGCAGCAAGCCAGTTTTGG - Intronic
952464183 3:33563683-33563705 AACAGGCAGCAGGGAAGATGTGG + Intronic
952956907 3:38563250-38563272 GTCAGGCAGCAGGCCATTTTTGG - Intronic
953057907 3:39402926-39402948 AACAAGCAGCAGGGCACAGTGGG + Intergenic
953231981 3:41073533-41073555 AACAGGCTGTAGGCTGAATTGGG - Intergenic
953319189 3:41956737-41956759 AGCAGGCAGCACACCCAATTTGG - Intronic
953403785 3:42650203-42650225 AAGAGGCAGCAGGCCTACCTGGG - Intergenic
953499443 3:43418849-43418871 AACAGGCTGTAGGCCAGTTTTGG - Intronic
953896661 3:46808447-46808469 AACAGGCAGCAGGACCCACTGGG + Intronic
954045135 3:47923377-47923399 AACAAGCAGAAGGCAATATTGGG + Intronic
954975036 3:54685424-54685446 AACTGGCAGTGGGCCAGATTTGG + Intronic
954975110 3:54686144-54686166 AATAGGCAGCAGGCCAGACTTGG - Intronic
955028885 3:55197442-55197464 AGCAGGCTGCAGGCTGAATTTGG - Intergenic
955037930 3:55286946-55286968 AAAGGGCAGCAGGCCAGATTTGG + Intergenic
955142864 3:56286779-56286801 AAAATGCTGCAGGCCACATTTGG + Intronic
955144733 3:56305767-56305789 AGCAGGCAAAAGGCCAGATTTGG - Intronic
955310587 3:57882667-57882689 AACAGGCAGCAGGTTGGATTTGG + Intronic
955422777 3:58755865-58755887 AACAGGCAGTGGGCCAGACTTGG - Intronic
955499603 3:59570755-59570777 AATAGACCACAGGCCAAATTTGG - Intergenic
955511833 3:59688840-59688862 AACAGGCTGTGGGCCAAATTTGG + Intergenic
955550872 3:60083822-60083844 AAGAGCCTGCAGGCTAAATTTGG - Intronic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955666991 3:61360307-61360329 ACCAGACAGCTGGCCAGATTTGG + Intergenic
955830308 3:62994520-62994542 AACAGTCCACAGGCCAGATTTGG + Intergenic
955960054 3:64331332-64331354 AACAGCCTAGAGGCCAAATTTGG - Intronic
956013343 3:64854992-64855014 AACAGGCAGTGGGTCAGATTTGG - Intergenic
956200620 3:66701826-66701848 AACAGGTGGCAGGCCAGATTTGG - Intergenic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956371053 3:68562222-68562244 AACAAGCAGCAAGCCAGATTTGG + Intergenic
956430706 3:69183355-69183377 AACAGGCAGCAGGATGGATTTGG + Intronic
956505372 3:69932436-69932458 TACAGGCAGCAGACCGAGTTGGG + Intronic
956509134 3:69976215-69976237 AACAAGTGGCAGGCCAGATTTGG + Intergenic
956524008 3:70137336-70137358 AATAGGCAACAGGACAAATTTGG - Intergenic
956635345 3:71358725-71358747 AACAGACAGTAAGCCATATTTGG - Intronic
956686412 3:71832691-71832713 AACTGGCAGCAGGCTAGATTTGG - Intergenic
956721175 3:72118875-72118897 CAGAGGCAGCAGGCCAGATTTGG - Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
956856328 3:73278532-73278554 AACAGGCAGTGGACCAGATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
956903910 3:73745603-73745625 AACGGGCAGTGGGCCAGATTTGG - Intergenic
956991233 3:74768215-74768237 AACAGGCAGCAGGCTGGATTTGG + Intergenic
957066182 3:75524325-75524347 AACAGTCAGAGGGCCAGATTTGG - Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
957251672 3:77779548-77779570 AAGTGGCAGCAGGCTAGATTTGG - Intergenic
957332621 3:78785891-78785913 AACAAGCAGCAGTCCAAAGAGGG + Intronic
957541741 3:81579965-81579987 AACAGGCAGCAGGTAGGATTTGG + Intronic
957551115 3:81706200-81706222 AACAGGTAGTGGGCCAGATTTGG + Intronic
957551116 3:81706213-81706235 AAAAGGCTGCAGGCCAAATCTGG - Intronic
958982936 3:100745776-100745798 AACAGGCAATAGTCCAGATTTGG - Intronic
958986370 3:100783819-100783841 AACAGGCAGTGAGCCAGATTTGG + Intronic
959627224 3:108466121-108466143 AACAGGCTGCAGGCTAGATTGGG + Intronic
959890753 3:111552673-111552695 AATAGGCAACAAGCCAGATTTGG + Intronic
960086925 3:113601412-113601434 AACAGGTGGCAGGCTAGATTTGG + Intronic
960263655 3:115595979-115596001 AATAGGTAGCAGGCCAAATTTGG - Intergenic
960507155 3:118507706-118507728 AACCGGTAGCAGGCTAGATTTGG + Intergenic
960604155 3:119487741-119487763 AACAAGCAGTGGGTCAAATTTGG + Intronic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960682629 3:120264911-120264933 AGCAGGCAGCAAGCCAACATGGG + Intronic
960735760 3:120778101-120778123 AACAGGCAAGAAGCCAAGTTGGG - Intronic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
960825756 3:121782474-121782496 AACAGGCAGCAGGCTGGATTTGG - Intronic
960980838 3:123224204-123224226 AATAGTCAGCAGGCTAGATTTGG + Intronic
961286961 3:125813714-125813736 AACAGTCAGAGGGCCAGATTTGG + Intergenic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962502169 3:136006584-136006606 AACAGGCAGTGGGCCAGATTTGG + Intronic
962668426 3:137679826-137679848 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
963081415 3:141398135-141398157 AACAGGTATCAGGCCAGATGTGG + Intronic
963808304 3:149748767-149748789 AATAGGTAGCAAGCCAGATTTGG + Intronic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
964361518 3:155902364-155902386 AACAGGTGGTAGGCCAGATTTGG - Intronic
964434009 3:156633481-156633503 TCCAGGCAGCAGGCCACATGTGG + Intergenic
964441964 3:156721069-156721091 GATAGGCAGCAGGCCAGATTTGG + Intergenic
964765727 3:160177108-160177130 AACAGGCAGAAGTCCAGATTTGG - Intergenic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966419844 3:179726616-179726638 GCCAGGCACCAGGCCAAGTTCGG - Intronic
966421550 3:179739275-179739297 AACAGGCAGCAGGGCAACTCTGG - Intronic
966549380 3:181187326-181187348 AACAGGCAGTGAGCCAGATTTGG + Intergenic
966672518 3:182543729-182543751 AATAGGCAGCAGGCTAGATTTGG + Intergenic
966954234 3:184857261-184857283 AACAGACGGCTGGCCAGATTTGG - Intronic
967654660 3:192032578-192032600 AACAGGCAGTGGGCTAAATTTGG - Intergenic
968167041 3:196474851-196474873 AACAGGCAGGAGGCTGGATTTGG - Intronic
968248007 3:197174112-197174134 AACAGGTGGCAGGCTACATTTGG + Intronic
969230551 4:5827302-5827324 CACAGGCAGCAGGCCATATGAGG - Intronic
969802653 4:9581580-9581602 AACAGTCAGAGGGCCAGATTTGG + Intergenic
970568631 4:17357418-17357440 AATAGGTAGCAGGCCAGATTTGG - Intergenic
970854867 4:20639463-20639485 AATAGGCAGCAAGCTAAATTTGG + Intergenic
971059937 4:22956500-22956522 AGCAGGCCACAGGCCATATTTGG + Intergenic
971092169 4:23358580-23358602 AACAGTCAGCAAGCTAGATTTGG - Intergenic
971228591 4:24778755-24778777 AAAAGGCACCAGACCAAACTTGG - Intergenic
971462907 4:26921557-26921579 AACAAGCAGCCAGCCATATTTGG + Intronic
971820826 4:31552288-31552310 AACAGGATGCATGCCAGATTTGG + Intergenic
972197962 4:36676880-36676902 AACAGGCAGCAGACTGGATTTGG + Intergenic
972297017 4:37749149-37749171 AACAGGCAGCAGACCCTATTTGG - Intergenic
972586726 4:40444361-40444383 AACAAACAGCAGGCCATATTTGG - Intronic
973208558 4:47588406-47588428 ATCAGACAGTAGGCCAAATTTGG - Intronic
973775611 4:54238673-54238695 AACAGGTTGCAGGCCAGGTTTGG + Intronic
973827000 4:54718070-54718092 AACAGGCTACAGGCCAATTCTGG - Intronic
974061819 4:57042272-57042294 AACAGATGGCAGGCCAGATTTGG - Intronic
974120661 4:57634092-57634114 AACAGGTGGTAGGCCAGATTTGG - Intergenic
974280948 4:59792294-59792316 AACAGGCAGCAAGATCAATTTGG + Intergenic
974870995 4:67641680-67641702 AATAGGCAGCATGCCTAATTAGG - Intronic
975305695 4:72846739-72846761 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
975943243 4:79673614-79673636 AACAGGTCGTAGGCCAGATTTGG + Intergenic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
976121328 4:81785594-81785616 AACAGGAAGCTGGCCACATTTGG + Intronic
976126260 4:81836552-81836574 AACAGGCAATCGGCCAGATTTGG + Intronic
976294834 4:83460107-83460129 AAAAGGGAGCAGGTCGAATTTGG - Exonic
977184604 4:93921100-93921122 AGTAGGCAGCAGGCCAGAGTTGG + Intergenic
978509189 4:109497049-109497071 AACAGGCAGTGGGCCCGATTTGG - Intronic
978750264 4:112238087-112238109 AATAGGCAGAGGGCCAGATTTGG + Intronic
978945166 4:114486687-114486709 AACAGGCTGCAGGCTGGATTTGG + Intergenic
979026808 4:115587900-115587922 AACACACAGCAGGGCAAGTTGGG + Intergenic
979357752 4:119725473-119725495 AACAGGCAGCAGGCTGGATTTGG - Intergenic
979588227 4:122445962-122445984 AAAAGGCAGCAGCCCCAGTTAGG - Intergenic
979693971 4:123590809-123590831 AACAGGCAGTGGGTCAGATTTGG + Intergenic
979841139 4:125441930-125441952 AACAGGCACTAGGCCCAATTTGG - Intronic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
979975736 4:127194197-127194219 AACAGGAAGCGGGCCAAATTTGG + Intergenic
980213937 4:129826866-129826888 AACAGGCGGTAGGCCAGATTTGG - Intergenic
980544634 4:134243937-134243959 AGTAGGCAGCAGACCAGATTTGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
981131092 4:141159459-141159481 AACAAGCAGCAGACAAGATTTGG + Intronic
981939999 4:150271842-150271864 AAAAGGCAGCAGCCCCAGTTAGG + Intronic
982050551 4:151497369-151497391 AACAGGTGACTGGCCAAATTTGG - Intronic
982235184 4:153245476-153245498 AACAGGCCGTGGGCCAGATTTGG - Intronic
982725571 4:158902642-158902664 AAAAGGCAGCAGCCCCAGTTAGG - Intronic
982936548 4:161484916-161484938 ATTAGGCAGTGGGCCAAATTTGG - Intronic
983671976 4:170247831-170247853 GACAGGCAATAGGCCAGATTTGG - Intergenic
984000738 4:174239981-174240003 AGCAGGCAGCAGGCCAGATCTGG - Intronic
984155185 4:176187653-176187675 AACAGGCAACAGGCTGAATTTGG + Intronic
984183131 4:176509599-176509621 AACAGGCAGTGGGCTAGATTTGG - Intergenic
984916449 4:184729608-184729630 AACAGGTGGCAGGCTAGATTTGG + Intronic
985858653 5:2451318-2451340 AGCAGGCAGCTGGCCAGATTTGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986362872 5:6998728-6998750 ACCAATCAGCAGGCCAAATAAGG + Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
986478012 5:8155315-8155337 AACAGGTAGTAGGCCATATTGGG - Intergenic
986583257 5:9287622-9287644 TATAGTCAGCAGGCCAAATCAGG + Intronic
986801412 5:11264379-11264401 AACAAACAGTGGGCCAAATTTGG + Intronic
987285741 5:16454675-16454697 AACAGGCGGTTGGCCAGATTTGG - Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
987419853 5:17706696-17706718 AACAGACAGTGGGCCAGATTTGG - Intergenic
987421999 5:17731170-17731192 AATAGGTGGCAGGCCAGATTTGG + Intergenic
987607817 5:20160827-20160849 TGCAGGCTGCAGGCCAAATTAGG + Intronic
987669246 5:20985994-20986016 AACAGACAAAAGGCCAAATTTGG - Intergenic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
988721145 5:33880527-33880549 AACAAGAGGCAGGCCAGATTTGG + Intronic
989280689 5:39639670-39639692 AACAAGTAGTAGGCCAAAATTGG + Intergenic
989468703 5:41789292-41789314 AATAGGCAGTGGGCCAGATTTGG + Intronic
990280754 5:54248380-54248402 AACAGCCAGGAGGCCAACTATGG - Intronic
990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG + Intronic
990433591 5:55764248-55764270 AGATGGCAACAGGCCAAATTAGG - Intronic
990626985 5:57624678-57624700 AACAGACAGCAGGGCTTATTTGG - Intergenic
990723506 5:58726477-58726499 AACAAGCAGTGGGCCAGATTTGG - Intronic
990958160 5:61364365-61364387 AACAGGTGGCAGGCCAGATTTGG - Intronic
990980506 5:61598615-61598637 AACAGCCTGCAGCCCAAATCTGG + Intergenic
990980509 5:61598628-61598650 AGCAGGCAGCAGACCAGATTTGG - Intergenic
991141304 5:63247049-63247071 AACAGGCAGGAGACCAGATGTGG - Intergenic
991345727 5:65665199-65665221 AAGAGGCAGCTGGGCAGATTTGG + Intronic
992035637 5:72772541-72772563 AACAGGTGGCAGGCCAGATTAGG + Intergenic
992243912 5:74797978-74798000 ACCAGGTGGCAGGCCAGATTTGG + Intronic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992594087 5:78328028-78328050 AACAGGCATTGGGCCAGATTTGG + Intergenic
992976871 5:82130001-82130023 AACAGGCAGCAGCCCCAGTCAGG - Intronic
993090167 5:83415801-83415823 AACAGGCTGCGGGCCAGATTTGG - Intergenic
993575939 5:89600938-89600960 AACAGGCAGTAGGGCAGATCTGG + Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
995074715 5:107969017-107969039 AACAGGCAGTAGGTTGAATTTGG - Intronic
995137628 5:108697112-108697134 AACAATGGGCAGGCCAAATTTGG - Intergenic
995659109 5:114461414-114461436 AACAGGCAGCCAGCCTGATTAGG - Intronic
995669945 5:114591578-114591600 AACAAGCAGAAGTCAAAATTTGG - Intergenic
995856989 5:116603621-116603643 AACAGGCAGTAGGCAGCATTTGG + Intergenic
995881096 5:116845470-116845492 AATAGGGAGAAGGCCAAAGTGGG - Intergenic
996124917 5:119713357-119713379 AACAGGAGGCAGGCCATATTTGG + Intergenic
996478489 5:123948023-123948045 AACAGGTTGCAAGCCAGATTTGG - Intergenic
996549373 5:124713356-124713378 AACAGACAGTGGGCCAGATTTGG - Intronic
996651582 5:125883729-125883751 AACAAGAAGCAGGACAAATATGG + Intergenic
997123952 5:131206841-131206863 AAAAGGCAGCAAGTCAGATTTGG - Intergenic
997216683 5:132117243-132117265 AAAAGGCAGCAGCCCCAATCAGG + Intergenic
997617092 5:135254438-135254460 AACAGGCAGAGGGCCAAGATTGG - Intronic
997841975 5:137250016-137250038 AACAGGTGGCAGGCCAGATTTGG - Intronic
998423734 5:142010143-142010165 TAAAGGCCGCAGGCCAAATTTGG - Intronic
998674862 5:144395892-144395914 AACAGGAAGCAGACCAGAGTCGG - Intronic
998790494 5:145761738-145761760 AGCAGGCAGCCGGCTAAATTTGG + Intronic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
998871031 5:146551901-146551923 AACAGGCAGCAGGCTGGATTTGG + Intergenic
999054723 5:148562101-148562123 AACAGACAGCAGGCTGGATTCGG - Intronic
999069868 5:148732883-148732905 AACAGGAAGTGGGCCACATTTGG - Intergenic
999235728 5:150092203-150092225 AACAGGAGGCAGGCTACATTTGG + Intronic
999649503 5:153751446-153751468 AACAGGCGGCAGGCTGGATTTGG - Intronic
999895863 5:156032765-156032787 ACCAGGCAGAAGCTCAAATTTGG + Intronic
1000008677 5:157211554-157211576 AACAGACAGCAGGCTGGATTTGG - Intronic
1000129130 5:158278172-158278194 AACAGGCAGCATGCTGGATTTGG - Intergenic
1000618314 5:163455064-163455086 AACAGGTAGTGGGCCAAATTTGG + Intronic
1000767068 5:165305337-165305359 AGAAGGCAGCAGTCTAAATTGGG - Intergenic
1000916754 5:167092100-167092122 AACAGGGGGCAGGACAAATCTGG - Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1000955351 5:167536520-167536542 AACAGGCTGCAGACTAGATTTGG + Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001010379 5:168092333-168092355 AACAGGCAGTGGGCCAGATTAGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001149588 5:169215616-169215638 AGCAGGCAGTGGGCCAAATTTGG + Intronic
1001220786 5:169898813-169898835 AACAGGTAGCAGGCAAGATTTGG + Intronic
1001420394 5:171581889-171581911 AACTGGCAGAGGGCTAAATTTGG - Intergenic
1001429338 5:171647134-171647156 AACAGGTGGTGGGCCAAATTTGG + Intergenic
1001709791 5:173769084-173769106 AACAGGCAAGGGGCCAGATTTGG - Intergenic
1001815160 5:174662406-174662428 AACAGGTAGTGGGTCAAATTTGG - Intergenic
1001923569 5:175619476-175619498 AACAGGCAGTAGGCTGGATTTGG + Intergenic
1002086351 5:176778060-176778082 AACAGGTGGTAGGCCAGATTTGG - Intergenic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1002838944 6:889264-889286 AACAGGCAGCAGGATGAATTTGG - Intergenic
1003026587 6:2560300-2560322 AACAGGCTTCAGGCCAAATGTGG - Intergenic
1003228674 6:4229489-4229511 AAAAGGCAGCAGCCCCAGTTGGG + Intergenic
1003304447 6:4913850-4913872 AACAGGAAGCAGCCCAGATTTGG + Intronic
1004206910 6:13599624-13599646 AACAGGTAGCAGGCCCAATGTGG - Intronic
1004217937 6:13719674-13719696 AACAAGCAGAAGGAAAAATTAGG - Intergenic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1005151407 6:22755937-22755959 TACAGGCAGAGGGCCAGATTTGG - Intergenic
1005152305 6:22766280-22766302 AACATGAAGGAGGCCAAATCTGG - Intergenic
1005489945 6:26338527-26338549 AACAGGTAGCAGGCCACATTTGG - Intergenic
1005525938 6:26648944-26648966 AACAGGTGGCAGGCCAGAATTGG - Intronic
1006649584 6:35539880-35539902 AAGAGATGGCAGGCCAAATTTGG - Intergenic
1006902109 6:37509673-37509695 AACAGGCAGCAAGCTGGATTTGG - Intergenic
1007941697 6:45787602-45787624 AACAGGCCGCTGGCCAGATGTGG + Intergenic
1008161767 6:48086368-48086390 AACAGGCAGCAGTCTGAATCTGG + Intergenic
1008239687 6:49094345-49094367 AGCAGGCACCAGGCCATGTTTGG + Intergenic
1008589688 6:52981648-52981670 AACAGGTGGCAGGCCAGGTTTGG + Intronic
1008737170 6:54559192-54559214 AACAGGCAGTGGGCTGAATTTGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1010065854 6:71681714-71681736 AGCAAGCAGCTGGCCAGATTTGG + Intergenic
1010129621 6:72475629-72475651 AATAGGCAACAGAACAAATTTGG - Intergenic
1010416082 6:75613149-75613171 AACAGGCAGCTGGACAAATTTGG - Intronic
1010437344 6:75849138-75849160 AACAGGCAGTGGGTCAAATTTGG - Intronic
1010535671 6:77026455-77026477 TACAGCCTGCAGGCCAAATATGG - Intergenic
1010735044 6:79434762-79434784 AACAGGCAGCGGGCTGAATTTGG - Intergenic
1010822651 6:80433320-80433342 AAAAGGCAGCAGCCCCAGTTGGG - Intergenic
1010973106 6:82284018-82284040 AAAAGGCAGCAGACCAAGTCAGG - Intergenic
1011207670 6:84917759-84917781 AACAGGTGGTAGGCTAAATTTGG - Intergenic
1011209200 6:84936529-84936551 AAAAGGCAGCAGGCCCAGTCAGG + Intergenic
1011546977 6:88492033-88492055 AACAGGCTGTGGGCCAGATTGGG - Intergenic
1011685749 6:89822137-89822159 AACAGCCAGGAGGCAAAATTTGG + Intergenic
1011696268 6:89916212-89916234 AACTGCCAGCAGGCCAAGTGCGG - Intergenic
1011812777 6:91152256-91152278 AATAGGCTGCAGGCTAGATTTGG + Intergenic
1012405191 6:98888191-98888213 AACAGGCAGTAGGCTGGATTTGG - Intronic
1012445531 6:99303568-99303590 ACCAGGCAGCATGACAAGTTAGG + Intronic
1012467778 6:99534687-99534709 AACAGGTAGCAGGTCAGATTTGG + Intergenic
1012837067 6:104282291-104282313 AACAGGTAGCAGTCCAAACTGGG + Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013320215 6:108980659-108980681 AAAAGGCAGCAGGCCCAGTCAGG - Intergenic
1013435642 6:110103152-110103174 AACAGGGAGCAGGTCAGATTTGG - Intronic
1013455418 6:110325430-110325452 AACAGGCAGCAGGCTGGATTGGG + Intronic
1013539640 6:111095210-111095232 AAAAAGCAGCAAGACAAATTTGG - Intronic
1013745248 6:113337647-113337669 ACCAGGCAGCAGGCCAGATGTGG + Intergenic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1014431805 6:121379828-121379850 AACTGGAGGCAGGCCAGATTTGG - Intergenic
1014486966 6:122010977-122010999 AACAGGTAGTAGGCTAGATTTGG + Intergenic
1014519886 6:122429089-122429111 GACAGGCAGCATGCTGAATTTGG + Intronic
1014727475 6:124989739-124989761 AACAGGCAGCAGGTTAGATGTGG + Intronic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015630540 6:135227960-135227982 AACAGGAAGTGGGCCAGATTTGG - Intergenic
1015650135 6:135447835-135447857 AACAGGTAGTAGGCCAGATTTGG - Intronic
1015726799 6:136307427-136307449 AACAGGCTGCAGGCTAAATTTGG - Intergenic
1015969268 6:138728048-138728070 AACAGGCAGTAGGATAAGTTTGG - Intergenic
1015977147 6:138801934-138801956 CACAGTCAGCAGGCCACATCTGG - Intronic
1016921679 6:149301083-149301105 AACAGGCAGAGGTCCACATTGGG + Intronic
1016929917 6:149394992-149395014 AACAGGCAGTGGGCTAGATTTGG + Intronic
1017265932 6:152446275-152446297 AACAGGCAACTGGCTAAATGTGG + Intronic
1017430000 6:154361617-154361639 AATAGGCAGCAAGCCAAAAGCGG + Intronic
1017440227 6:154457998-154458020 AACAGGCAGCTGGCAGGATTTGG - Intronic
1017631756 6:156402774-156402796 AACAGGCAGAGGGCCAGATTTGG - Intergenic
1017789993 6:157789489-157789511 AAGAGGCAGCAGGCTGGATTTGG + Intronic
1017897698 6:158695039-158695061 AACAGCCTGCAAGCCAAATCTGG + Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1019553451 7:1616546-1616568 AGCAGGCAGCAGGCTGGATTTGG - Intergenic
1019911636 7:4104001-4104023 AACAGGAAGTGGGCCAGATTCGG + Intronic
1020352257 7:7233726-7233748 AACAGGTAGCAGGCCAGGTTTGG + Intronic
1020375081 7:7476391-7476413 AACAGGCAGTGGGCTGAATTTGG - Intronic
1020579630 7:9979705-9979727 AACAGGCAGCGGGCTGGATTTGG + Intergenic
1020778929 7:12494063-12494085 AAAAGGCAACAGGCTAAATAAGG + Intergenic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1020912984 7:14156610-14156632 AACAGGCAGCTGGTCAGATTTGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021206039 7:17782307-17782329 AAAAGGCAGCAGGCCCAAAATGG + Intergenic
1021348250 7:19554903-19554925 AACAGGCAGCTGACTAGATTTGG - Intergenic
1021532779 7:21667469-21667491 AACAGGTGGTGGGCCAAATTTGG + Intronic
1021548551 7:21844079-21844101 AAGAGGTGGCAGGCCAAATTAGG - Intronic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021695890 7:23276111-23276133 AACAGGTGGTAGGCCAGATTTGG + Intergenic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1022255205 7:28649250-28649272 AACAGGTGGCAGGCTGAATTTGG - Intronic
1022270493 7:28802784-28802806 ATTAGGCAGCGGGCCAGATTTGG - Intronic
1023385252 7:39650263-39650285 AACAGGCAGCAGGCTGAATTTGG - Intronic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1023654273 7:42404064-42404086 AATAGGCAGCAACCCAGATTTGG - Intergenic
1024410163 7:49031265-49031287 AAGAGGCAGTGGACCAAATTTGG + Intergenic
1024664237 7:51529889-51529911 TATAGCCAGCAGGCCAAATCTGG + Intergenic
1025845571 7:65193500-65193522 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025895790 7:65699213-65699235 AGCAGGCAACAGGCCAGCTTTGG - Intergenic
1025971241 7:66327916-66327938 CACAGCCTGCAGGCCAAATCTGG + Intronic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1026949264 7:74336681-74336703 AATAGGCAGCAGGACTGATTTGG - Intronic
1027329523 7:77077267-77077289 AACAGGCCCCTGGCCAGATTTGG - Intergenic
1027680622 7:81216267-81216289 AACAGGACACAGGCCAAATTTGG - Intergenic
1027723336 7:81771394-81771416 AAAAGAAAGCAGGCCAAATGTGG + Intergenic
1027778188 7:82492386-82492408 AACAGGCAGCAGCCCCAGTAAGG - Intergenic
1027928960 7:84506499-84506521 AATAGGCAGTAGGGCAAATTTGG + Intergenic
1028128382 7:87141716-87141738 AACAGTCAGCAGGAAAACTTAGG + Intergenic
1028340401 7:89712380-89712402 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1028357349 7:89925403-89925425 AACAGACAGCAGGCTGAATTTGG - Intergenic
1028572968 7:92312661-92312683 AACAGGCAGCAGGTTTGATTTGG + Intronic
1028630238 7:92926345-92926367 AAAAGGCAGCAGCCCAAGTCAGG - Intergenic
1028713255 7:93935299-93935321 AACAAGCAGCAGGCTGAATTTGG + Intergenic
1028932920 7:96433747-96433769 AACAAGCAGTGGGCCAAATTTGG + Intergenic
1029011274 7:97264272-97264294 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1029051501 7:97693765-97693787 ACCAGGCAGTGGGCCAGATTTGG + Intergenic
1029786239 7:102794094-102794116 AACAGGCCCCTGGCCAGATTTGG + Intronic
1030346686 7:108441762-108441784 AATTGGCGGCAGGCCAGATTTGG - Intronic
1030778134 7:113562446-113562468 AACTGGCAGCAGGCTGGATTTGG + Intergenic
1030797740 7:113809684-113809706 AACAGGCAACGGGCCAGATGGGG - Intergenic
1031189684 7:118531779-118531801 AACAGGCAGAAGGCTAGATTTGG + Intergenic
1031930217 7:127677827-127677849 AACAGGCAGTAGGCTGGATTTGG + Intronic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1032312553 7:130802185-130802207 AAAAGGCAGCAGCCCCAATCAGG - Intergenic
1032426668 7:131828135-131828157 AAAAGGCACCAGGCAGAATTTGG - Intergenic
1032865763 7:135922476-135922498 AACAGGCAATGGGCCAGATTCGG + Intergenic
1033525644 7:142210671-142210693 AAAAGGCAGCAGCCCCAGTTAGG + Intronic
1034507917 7:151509679-151509701 AACAGGCTGTAGGCCAAATTTGG - Intronic
1034877296 7:154736526-154736548 AAGAGACAGCAAGCCAGATTTGG + Intronic
1035710786 8:1712361-1712383 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
1036163267 8:6407810-6407832 AACAGGCAGCAGGCTAGATATGG - Intronic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036248481 8:7141271-7141293 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1036252325 8:7173066-7173088 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1036365169 8:8114394-8114416 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1036505789 8:9354440-9354462 AATAGACAGTGGGCCAAATTTGG - Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1036893387 8:12610793-12610815 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1037072772 8:14673009-14673031 AACACACAGCAGGCAAGATTTGG + Intronic
1037352081 8:17971214-17971236 AACAGGCAGCAGGCTGAATTTGG + Intronic
1037622322 8:20575670-20575692 AACAGGCAGTAGGCCAGAGTTGG + Intergenic
1038536601 8:28358054-28358076 AACAAGCAGCAGGCTACATTGGG - Intronic
1039080329 8:33727846-33727868 AACAGGCACCAAGCCACACTTGG - Intergenic
1039104068 8:33971216-33971238 AATAGGCTGCAGGCCAGATTTGG - Intergenic
1039265866 8:35823270-35823292 AACAGGTAGCTGGCTAGATTTGG + Intergenic
1041123216 8:54608165-54608187 AAAAGGCAGATGGCCAAAATAGG - Intergenic
1041541317 8:58988306-58988328 AGCAGACAGCAGACCAGATTTGG - Intronic
1041813204 8:61935792-61935814 AACAGGCAGAAGGAAAAATTAGG + Intergenic
1042029402 8:64459191-64459213 AACAGGTAGCAGGCTAGCTTGGG + Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1042521826 8:69720964-69720986 AACAGGAAGCAGGCTAACTTTGG + Intronic
1043326311 8:79056175-79056197 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1043780455 8:84327505-84327527 AAGAGGTAGCAGGCCAGATATGG - Intronic
1043843000 8:85130900-85130922 AAAAGGCAGTAGGTCACATTTGG + Intronic
1043843081 8:85132254-85132276 AATAGGCAGTGGGCCATATTTGG - Intronic
1043851499 8:85221278-85221300 GACTGGCAGCTGGCCAAGTTAGG + Intronic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1044387999 8:91612757-91612779 AGCAGGCAGTGGGCCAGATTTGG + Intergenic
1044488031 8:92776281-92776303 TACAGGCAGCATGGCAGATTTGG + Intergenic
1044519330 8:93179495-93179517 AACAAGGAGCAGGCCACAGTAGG + Intergenic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045181521 8:99788788-99788810 AATAGGCTACATGCCAAATTTGG + Intronic
1045564942 8:103304679-103304701 AACAGGCAGTGGGCTATATTTGG + Intronic
1045576587 8:103428310-103428332 AACAGGCAGTGGGCCACATGTGG - Intronic
1045866530 8:106872145-106872167 ACCATGAAGCAGGTCAAATTAGG + Intergenic
1045952988 8:107872863-107872885 AACATGCACCAGGGCATATTGGG - Intergenic
1046128474 8:109940123-109940145 AACAGTCTGCAGGGCAAACTAGG - Intergenic
1046128477 8:109940150-109940172 AACAGTCTGCAGGGCAAACTAGG - Intergenic
1046128481 8:109940177-109940199 AACAGCCTGCAGGGCAAACTAGG - Intergenic
1046128485 8:109940204-109940226 AACAGCCTGCAGGGCAAACTAGG - Intergenic
1046128488 8:109940231-109940253 AACAGTCTGCAGGGCAAACTAGG - Intergenic
1046128492 8:109940258-109940280 AACAGCCTGCAGGGCAAACTAGG - Intergenic
1046262963 8:111794602-111794624 AATAGCCAGAAGGCCAAATAGGG + Intergenic
1046364305 8:113205969-113205991 AAAGGGCATCAGGCCATATTTGG - Intronic
1046753703 8:117951755-117951777 AACAGGTGGCAGGCCAGATTTGG - Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1046964497 8:120148892-120148914 AATAGGCAGTGGGCCAGATTTGG - Intronic
1047026790 8:120833109-120833131 AACAGGTAGCAGGTCAGATTTGG - Intergenic
1047414020 8:124649122-124649144 AACAGGCAGTGGGCCGGATTTGG - Intronic
1047425719 8:124743836-124743858 AGCATGCAGTAGGCCAGATTTGG - Intergenic
1047676781 8:127211236-127211258 AACAGGTGGCAGGACAGATTTGG + Intergenic
1047886115 8:129251739-129251761 ACCAGGCAGCAGGCTAGATTTGG - Intergenic
1047892665 8:129329885-129329907 AACAGGTAGAAAGCCAGATTTGG + Intergenic
1048455991 8:134578927-134578949 AGCAGGAAGTAGGCTAAATTTGG - Intronic
1050094397 9:2048163-2048185 AACAGGCTGGAGGCAGAATTTGG + Intronic
1050378162 9:4994695-4994717 AACAGGCAGCTGGCTAAATTTGG + Intronic
1050404521 9:5293557-5293579 AACAGGCAGCAGCCCCAGTCAGG + Intergenic
1050422873 9:5485109-5485131 AACAGGCAGTAAACTAAATTTGG + Intergenic
1050440534 9:5657767-5657789 AACAGGCACCAGGGCATATTTGG - Intronic
1050622072 9:7464535-7464557 AACAGGCAGCAAGCTAGATTTGG + Intergenic
1050859522 9:10409030-10409052 AACAGGCTGTAGGCCAGATTTGG - Intronic
1051066560 9:13111141-13111163 AACAGGCAGTGGGCCAAATTTGG - Intronic
1051105297 9:13572396-13572418 AAGAGGAAGAAGGCCAGATTTGG - Intergenic
1051207095 9:14699472-14699494 AACGAGCAGCAGCCCATATTTGG + Intergenic
1051262638 9:15279836-15279858 AAAAGGCAGCAGGTGGAATTTGG - Intronic
1051486456 9:17613905-17613927 ACCAGGCAGCTTGCCAAATAAGG - Intronic
1051608720 9:18941494-18941516 AACAGGCTGCTGGCCAGATCTGG + Intronic
1051616027 9:19007678-19007700 AACAGGTAGCAAGCTGAATTTGG - Intronic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1051845466 9:21447108-21447130 GACAGGCAGCAAGCCAAGTTGGG - Intergenic
1052238104 9:26237354-26237376 AACAGGCAGCAGGCCAGAGCTGG + Intergenic
1052329421 9:27251979-27252001 AAAAGGCAGCAGCCCCAGTTAGG + Intergenic
1052480266 9:29015555-29015577 AATAGACAGCAGGTCAGATTTGG + Intergenic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1053191850 9:36078132-36078154 AACAGGTGGCAGGCAAGATTTGG + Intronic
1053362318 9:37497503-37497525 CACAGGCAGCAGGCCAGACTTGG - Intronic
1053678603 9:40464156-40464178 ACAAGGAAGTAGGCCAAATTGGG + Intergenic
1053928587 9:43092510-43092532 ACAAGGAAGTAGGCCAAATTGGG + Intergenic
1054285121 9:63160786-63160808 ACAAGGAAGTAGGCCAAATTGGG - Intergenic
1054291681 9:63299694-63299716 ACAAGGAAGTAGGCCAAATTGGG + Intergenic
1054389697 9:64604237-64604259 ACAAGGAAGTAGGCCAAATTGGG + Intergenic
1054506015 9:65912139-65912161 ACAAGGAAGTAGGCCAAATTGGG - Intergenic
1054981281 9:71209665-71209687 AAGAGGCAGCAGGCTGGATTTGG - Intronic
1055134594 9:72813684-72813706 AACAGGTGGCAGTCCAGATTTGG + Intronic
1055311643 9:74988803-74988825 AATAGGCTACAGGCCAAATTGGG + Intronic
1055537030 9:77258693-77258715 AACAAGCAGCAGACATAATTTGG - Intronic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1055862998 9:80776183-80776205 AACAGCCCACAGGCCAAATCTGG - Intergenic
1055949908 9:81720881-81720903 AACAGGCTTCAGGCCAAAGCTGG - Intergenic
1056104192 9:83330631-83330653 CACAGGTGGCAGGCCACATTTGG - Intronic
1056140390 9:83672873-83672895 AACAGCCTGCAGGACAAATCTGG + Intronic
1056145490 9:83724789-83724811 AACAGGCAGCAGATCTGATTTGG + Intergenic
1056255491 9:84795220-84795242 ACCTGGCAGCAGGACAAAGTAGG - Intronic
1056285919 9:85088129-85088151 AACAGGCTGCAGGCCAGCTTTGG + Intergenic
1056302604 9:85257806-85257828 GAAAGGCAGCAGCCCCAATTAGG - Intergenic
1056879466 9:90377406-90377428 AACAGGCTGTAGGCCAATTTTGG - Intergenic
1057198825 9:93129780-93129802 CCCAGGCAGCAGGCCACATTGGG + Intronic
1057523614 9:95780399-95780421 AAAAGGCAGGAGGGCAAATAGGG + Intergenic
1057552538 9:96062621-96062643 AACAGGCAGTGGGCCAGATTTGG + Intergenic
1057763706 9:97897490-97897512 AACAGGCTGTGGGCCAGATTTGG + Intergenic
1058167370 9:101635276-101635298 AACTGGTAGCAGGCTAGATTTGG - Intronic
1058468417 9:105251956-105251978 AACAGGTAGCAGGTCAGATTTGG - Intronic
1058608232 9:106746483-106746505 AAAATGAAGCAGGCCAAATGAGG + Intergenic
1058646776 9:107138403-107138425 AACAGGCAGTGGGCCAAATTTGG - Intergenic
1058938766 9:109793698-109793720 AAGAGGCTGCAGGCTGAATTTGG - Intronic
1059095778 9:111412633-111412655 AACAGGAGGCAGGCCCTATTTGG + Intronic
1059108736 9:111534662-111534684 AACAGGAAGGAGGGCAGATTGGG + Intronic
1059173717 9:112150217-112150239 AACAGGCAGCAGGTCGAACTTGG + Intronic
1059191029 9:112326436-112326458 AACAGGTGGCAAGCCAAATGTGG + Intronic
1059319600 9:113458342-113458364 AACAGGCAGCCAGCCAGATTTGG + Intronic
1059666377 9:116450139-116450161 AATAGGCAGTGGGCCAGATTTGG - Intronic
1059909099 9:119022575-119022597 AACAGGAAGGAGGTCAGATTTGG - Intergenic
1059946867 9:119418139-119418161 AACAGGCAATAGGCCAGACTTGG + Intergenic
1059954623 9:119502658-119502680 GAAAGGCAGCAGGCCCAGTTAGG + Intronic
1060302117 9:122380523-122380545 TACAGCCTGCAGGCCAAATTCGG + Intronic
1060363108 9:122980040-122980062 AACAGGTGGCAGACCAGATTAGG - Intronic
1060382712 9:123191738-123191760 AACAGGCAATGGGCCAAATTTGG + Intronic
1060532690 9:124357348-124357370 AACAGGCAGTGGGCCAGATCTGG + Intronic
1060771572 9:126335891-126335913 AACGGGGGGCAGGCTAAATTGGG - Intronic
1061538537 9:131264698-131264720 AAAAGGCTTCAGGTCAAATTAGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1062059125 9:134485490-134485512 AGCAGGCAGCAGGCCACATGTGG - Intergenic
1203531317 Un_GL000213v1:145357-145379 AAGTGGCAGCAGGCTAGATTTGG - Intergenic
1185816190 X:3158295-3158317 AACAGGCTGTGGGCCAGATTTGG + Intergenic
1186157654 X:6742303-6742325 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1186335012 X:8577066-8577088 ACCAGGTTGCAGGCCAAATTTGG + Intronic
1186343039 X:8663380-8663402 AATAGGTAGCAGGGCAGATTTGG + Intronic
1186370592 X:8942921-8942943 AACATGTAGCAGGCCAAATTTGG + Intergenic
1186519595 X:10193782-10193804 AACAGGCTGTGGGCCAGATTTGG + Intronic
1186546320 X:10453586-10453608 AACAGGCAGAGGGCCAGAGTTGG - Intronic
1186546417 X:10454529-10454551 ACCAGGTAGCAGGCCAGGTTTGG + Intronic
1186547976 X:10470912-10470934 AACAGGCAGTGGGCCAGACTTGG - Intronic
1186673305 X:11789115-11789137 AGCAGGCAGGAGGCCTGATTTGG - Intergenic
1186701949 X:12099950-12099972 AACAAGCCACAGGCCAGATTTGG - Intergenic
1186706342 X:12143264-12143286 AACAGTCAGCAAGCCAGATTTGG - Intronic
1186708674 X:12169926-12169948 AACAGGCAGTGGGCCAGATTTGG + Intronic
1186748105 X:12591514-12591536 AACAGGCAGAGGGCCAGATTTGG - Intronic
1186753162 X:12642564-12642586 AACAGGTAGTAGGCCAGATTTGG - Intronic
1186842521 X:13498373-13498395 AACAGGCAGTATGCCAGATTTGG - Intergenic
1186846153 X:13533075-13533097 AACAGGAAGCAGGACACATTTGG - Intergenic
1186872040 X:13782812-13782834 AACAGGTAGTAGGTCAAATTTGG + Intronic
1186896322 X:14007962-14007984 AACAGACTGCAGGCCAGATTTGG - Intergenic
1186904169 X:14093541-14093563 GACAGGCAGCATGCCACATGCGG - Intergenic
1186927715 X:14353343-14353365 AACAAGCAGTAGGCCAGATTTGG - Intergenic
1186945485 X:14561405-14561427 AACAGGTGGTAGGCCAGATTCGG - Intronic
1187019492 X:15365482-15365504 GGCAGGCAGCAGGCTAAATTAGG - Intronic
1187020725 X:15378718-15378740 AACAGGCTGCAGGTTAGATTTGG - Intronic
1187027885 X:15455022-15455044 AAAAGGAATCAGGACAAATTAGG - Intronic
1187040844 X:15594143-15594165 AACAGGCAGCAGACAGGATTTGG - Intronic
1187186143 X:16987753-16987775 AACAGACAGTGGGCCAGATTTGG + Intronic
1187502668 X:19852719-19852741 GAAGGGCAGCAGGCCTAATTTGG - Intronic
1187563107 X:20420830-20420852 AACAGGCAGAGGGCTATATTTGG + Intergenic
1187708279 X:22028666-22028688 AACAGGCAGTGGGCCAAATTTGG + Intergenic
1187721844 X:22159282-22159304 AACAGGCAGAATGCCAAATATGG - Intronic
1187724498 X:22188482-22188504 AACAGGCAGCAGGTGAGATTTGG - Intronic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1187744215 X:22390476-22390498 AACAGGTAGTAGCCCAAATTTGG - Intergenic
1188454700 X:30350551-30350573 AACAGGCCGTAAGCCAGATTTGG + Intergenic
1188472649 X:30557849-30557871 AGCAGGCAGCAGGCTAGATCTGG + Intergenic
1188644208 X:32544078-32544100 AACTGGCAGCATGCTAAATTTGG + Intronic
1189339717 X:40195564-40195586 AACAGGCAGCTGGCCAGATCTGG + Intergenic
1189469246 X:41301361-41301383 AACTGGAAGCAGGCCAGAGTTGG - Intergenic
1189778294 X:44489740-44489762 AACAGACAGCAGGGTAGATTTGG + Intergenic
1189841894 X:45088503-45088525 AACAGGCAGTGGGCTGAATTTGG + Intronic
1190027596 X:46939802-46939824 AACAGGTAGCAGACTAGATTTGG - Intronic
1190755330 X:53396410-53396432 AGCAGGCAGCCTGCCAGATTTGG - Intronic
1190794506 X:53728502-53728524 AACAGGCAGCAGGCTGGATTTGG - Intergenic
1191788734 X:64945737-64945759 AAAAGGCAGCAGTCCCAGTTAGG - Intronic
1192182560 X:68925356-68925378 TACAGCCTGCAGGCCAAATCTGG + Intergenic
1192182562 X:68925369-68925391 AACAGGCAGTGGGCCAGATTTGG - Intergenic
1192220416 X:69194060-69194082 AAGAGGCAGCAGGCAAACCTTGG + Intergenic
1192296412 X:69853930-69853952 AACACACTGCAGGCCAGATTTGG + Intronic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192489784 X:71565819-71565841 AACTGGCAGTATGCCAGATTTGG + Intronic
1192710938 X:73587024-73587046 AACAGGCAGCAAGCCAGATCTGG + Intronic
1192802140 X:74476263-74476285 AACAGACAGAAAGCCAAATCAGG - Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1194391202 X:93319917-93319939 AAAAGGCAGCAGCCCCAATCAGG + Intergenic
1194842345 X:98758932-98758954 AACAAGCAGTAAGCCAAATTTGG - Intergenic
1195278539 X:103308146-103308168 AATAGGCAGTGGGCCAGATTTGG + Intergenic
1195374151 X:104209839-104209861 AACATGCAGCAGGCTGGATTTGG - Intergenic
1195415095 X:104611315-104611337 AAAAGGCAGCAGCCCCAATCAGG - Intronic
1195425843 X:104729429-104729451 AAAAGGCAGCAGGCCCTATTTGG - Intronic
1195447223 X:104966982-104967004 AACAGGCAGTAGGCCAGTCTTGG + Intronic
1195590158 X:106615326-106615348 AACAAGCAACAGGCAAGATTTGG + Intronic
1196991833 X:121337843-121337865 ACTAGGCAGCAGGCAGAATTTGG - Intergenic
1197051010 X:122059858-122059880 ATCATGCAGCAGTCTAAATTAGG - Intergenic
1197605959 X:128585426-128585448 AAGAAGTGGCAGGCCAAATTTGG - Intergenic
1198419620 X:136457396-136457418 AACAGATGGCAGGCCAGATTTGG + Intergenic
1200300109 X:154965646-154965668 AGCAGGCCACAAGCCAAATTTGG + Intronic
1201469881 Y:14321441-14321463 AACAAGCAGTAGGCCAGATTTGG - Intergenic
1201551207 Y:15218709-15218731 AGCAGGCAGTGGGCCAGATTTGG - Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic
1202350426 Y:23984264-23984286 AAAAAGTAGCAGGCCAAATTAGG - Intergenic
1202520353 Y:25685857-25685879 AAAAAGTAGCAGGCCAAATTAGG + Intergenic