ID: 975329350

View in Genome Browser
Species Human (GRCh38)
Location 4:73096998-73097020
Sequence GCAAACAAACTGATGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975329350_975329355 13 Left 975329350 4:73096998-73097020 CCTTGAACCATCAGTTTGTTTGC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 975329355 4:73097034-73097056 GTAGGAGGAATTTAATTATAAGG 0: 1
1: 0
2: 2
3: 14
4: 219
975329350_975329352 -5 Left 975329350 4:73096998-73097020 CCTTGAACCATCAGTTTGTTTGC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 975329352 4:73097016-73097038 TTTGCAACCTTTAGAAGAGTAGG 0: 1
1: 0
2: 0
3: 10
4: 178
975329350_975329353 -2 Left 975329350 4:73096998-73097020 CCTTGAACCATCAGTTTGTTTGC 0: 1
1: 0
2: 0
3: 6
4: 125
Right 975329353 4:73097019-73097041 GCAACCTTTAGAAGAGTAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975329350 Original CRISPR GCAAACAAACTGATGGTTCA AGG (reversed) Intronic
902112672 1:14095775-14095797 GCAAACAAACAGAAGCTTCATGG + Intergenic
904940187 1:34160293-34160315 GCAATCAAGCTGAGGGTTTATGG - Intronic
904962285 1:34343455-34343477 GCAAAGAAGCTGATGGTACCAGG + Intergenic
906228670 1:44141682-44141704 GCAAAAAAATTGATAGGTCAGGG + Intergenic
906975854 1:50572260-50572282 GCAAACATTCAGATGTTTCAGGG - Intronic
907898131 1:58712244-58712266 GAAAACAGAATTATGGTTCAGGG + Intergenic
909894771 1:81053917-81053939 ACAAACAAATTGATAGTCCAGGG + Intergenic
913701080 1:121375078-121375100 GCAAGCACTCTGATGGATCATGG - Intronic
914041634 1:144055546-144055568 GCAAGCACCCTGATGGATCATGG - Intergenic
914451843 1:147799656-147799678 GCAAAGCAACTGATGATTAAGGG + Intergenic
914795324 1:150915367-150915389 CCAAACAAACTGAAGGTCCATGG - Intergenic
918957666 1:191231121-191231143 GTAAACAATCTGAAGGTTGAAGG + Intergenic
919105330 1:193142775-193142797 GGAAACAAATTGCTGGTTAAAGG + Intronic
920488501 1:206393798-206393820 GCAAGCACCCTGATGGATCATGG - Intronic
920646658 1:207808625-207808647 GTAAACAAACCACTGGTTCACGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922093184 1:222417235-222417257 GTAAACAGAGTGTTGGTTCATGG - Intergenic
923940443 1:238817389-238817411 CCTATCAAACTTATGGTTCATGG + Intergenic
1062894624 10:1093746-1093768 GCAAACATACTGATGCTGTACGG - Intronic
1065914619 10:30343513-30343535 GCTATGAAACTGATGGATCAAGG + Intronic
1068101058 10:52553788-52553810 TTAAACAAATTTATGGTTCAAGG - Intergenic
1072342822 10:94471556-94471578 GCAAACAAAGGCATGGATCAGGG - Intronic
1072343568 10:94480140-94480162 GAAAACAATCAGATCGTTCAGGG - Intronic
1073796501 10:106994099-106994121 GCAAACAAATTCATAATTCATGG + Intronic
1080005750 11:27404655-27404677 TCAAACAGAGTGATGGTGCAAGG + Intronic
1082663472 11:55945031-55945053 GCCAACAATCTCATGGATCATGG - Intergenic
1083621054 11:64049608-64049630 ACAGACATCCTGATGGTTCAGGG + Intronic
1091142269 11:133245397-133245419 GCAAACCAACTGGCAGTTCAAGG + Intronic
1092684068 12:11021586-11021608 GAAAACAAACTGATGGTGTCTGG - Intronic
1096098489 12:48954174-48954196 ACATCCAAATTGATGGTTCAGGG + Intronic
1098417789 12:70255754-70255776 GCAAACTAACTGAGGATTTAGGG - Intronic
1098742259 12:74188025-74188047 CCAAACAAACCAATGGATCAAGG + Intergenic
1100064378 12:90623793-90623815 GGAAACAAACTAAAGGTTGAGGG + Intergenic
1102155873 12:110727310-110727332 GGAAACAAACTGATTTTTGATGG - Intronic
1104091124 12:125518534-125518556 GGAAACAGGCTGATGGATCAGGG + Intronic
1106103298 13:26712931-26712953 ACACACAAACTGATGGGTGATGG - Intergenic
1108435897 13:50401229-50401251 GCAAACAACCTCCTGGTTCTTGG - Intronic
1111974845 13:94955060-94955082 GGAAACAAACTGATGATGAATGG + Intergenic
1117204095 14:53423594-53423616 GTAAACAAACTGATGGGGCTTGG - Intergenic
1120917903 14:89726242-89726264 AAAAACACACTGATGGTTCATGG + Intergenic
1121515319 14:94545733-94545755 GCAAAGAAAGTGATGGTCCCTGG - Intergenic
1126350501 15:47740692-47740714 GGAAATAAACTGAGGGCTCACGG - Intronic
1130627500 15:85530789-85530811 CCAAATAAACTGATGGTGGATGG - Intronic
1130856598 15:87844601-87844623 GCAGACATGCTTATGGTTCATGG - Intergenic
1131864974 15:96698485-96698507 GAAAACAAAATGATGGCACAAGG - Intergenic
1133956256 16:10446596-10446618 GCCAAAAAACTGAGGGTTCGAGG + Intronic
1134487163 16:14667709-14667731 GCAAACAAACTGAGGGATGAGGG - Exonic
1135353230 16:21748006-21748028 GAAAAGAAAATGATGGTTCTAGG - Intronic
1135451717 16:22564129-22564151 GAAAAGAAAATGATGGTTCTAGG - Intergenic
1137833805 16:51571032-51571054 GTCTACAAACTGGTGGTTCATGG + Intergenic
1147646747 17:42038840-42038862 GTACACAAGCTGGTGGTTCAAGG - Intronic
1149587996 17:57806352-57806374 GACAAGAAACTGATGGGTCAGGG - Intergenic
1150033636 17:61769105-61769127 GCAAACAAACTGAGGGACCCTGG + Intronic
1152113003 17:78367455-78367477 GCAAACAAAATGCTGGTGGAGGG + Intergenic
1156783084 18:40875760-40875782 GCAAATAAACTCAGTGTTCATGG + Intergenic
1158042032 18:53106115-53106137 GAAAACAATCTGATGTGTCAGGG - Intronic
1165389052 19:35527872-35527894 GCAGACAAACTGATCCATCATGG - Exonic
1167347023 19:48952664-48952686 CAAAACAAACTGATCCTTCAAGG + Intergenic
926387029 2:12345968-12345990 AGAAACAAACTGATATTTCACGG + Intergenic
928726278 2:34177397-34177419 GCAAACATAGTGAGAGTTCAGGG + Intergenic
929387491 2:41427006-41427028 GCAAGCATAGTCATGGTTCACGG + Intergenic
929519248 2:42632802-42632824 ACACACAAACAGATGTTTCAGGG + Intronic
931144167 2:59498504-59498526 GCAAACTAAATAATGGCTCAAGG + Intergenic
933207458 2:79523504-79523526 ACAAACAAACTGAATGTACATGG - Intronic
933240107 2:79910973-79910995 TCAAAGAATCTGAAGGTTCATGG - Intronic
935130854 2:100259813-100259835 ACAAACAAGGTGATGGTACAGGG + Intergenic
935935638 2:108179808-108179830 GCCAAGAAATTGATGTTTCATGG - Intergenic
936280158 2:111132099-111132121 GCACACCCACTGAAGGTTCAGGG - Intronic
939148221 2:138441971-138441993 GCAAAGAAACAGATGGTACCTGG + Intergenic
939357569 2:141123282-141123304 GCAAAGAAACTGTTGTTTTAAGG - Intronic
941577490 2:167251385-167251407 TGAAATAAACAGATGGTTCAGGG + Exonic
943204726 2:184879077-184879099 ACAAACAAAATGATGCCTCACGG + Intronic
944649952 2:201819802-201819824 GCAAAGAAACTGTGGGTTGAAGG + Intronic
948450045 2:238063630-238063652 GCAAAGAAACTGAAAGTGCAAGG + Intronic
1173277234 20:41595781-41595803 AAAAGCAAACTGAGGGTTCAAGG - Intronic
1175303303 20:57958391-57958413 TCAACCAAACTGCTGGTTGAGGG - Intergenic
1178158391 21:29881912-29881934 GCAAACAAATGGATGGTTGTTGG - Intronic
950035125 3:9879712-9879734 GCAATGAAACTGAGGCTTCAAGG - Intronic
950619015 3:14187723-14187745 CCCAACAACCTGATGGTTTATGG - Intronic
951188169 3:19738780-19738802 ACAAACAAACTCATGTCTCATGG - Intergenic
951413362 3:22392530-22392552 GCAAACTTACTGAAGGTTCTAGG - Intergenic
957381701 3:79438946-79438968 GCAAATGAACTGATGCTTAAAGG - Intronic
959095200 3:101948227-101948249 TCAAACAAACTCATTCTTCATGG + Intergenic
959838261 3:110945810-110945832 GCAACCAAACTTATGAATCATGG + Intergenic
963725642 3:148917869-148917891 TCAAACAAACTGAAGAATCAAGG + Intergenic
968274360 3:197428609-197428631 GCAGACAAACTGATTCATCATGG - Intergenic
969879064 4:10157986-10158008 GGAAACAAGCTGATGGCTCTTGG + Intergenic
971774854 4:30950005-30950027 GCAAACAAACTCAGGGTTTTTGG + Intronic
972330729 4:38062544-38062566 GCCAAGAATCTGATTGTTCATGG + Intronic
974909677 4:68101998-68102020 GCAAACAAAATGGTGGTTATAGG - Intronic
975329350 4:73096998-73097020 GCAAACAAACTGATGGTTCAAGG - Intronic
976753073 4:88469963-88469985 GTACACAAACTAATGGTTCCAGG - Intronic
981927095 4:150152181-150152203 GCTAACATACTGAAGGTTCATGG - Intronic
982282527 4:153699593-153699615 ACAAACCAACAGATAGTTCAAGG - Intergenic
982691862 4:158557376-158557398 ACAAACAAACTGATACTTTAAGG - Intronic
984134715 4:175921727-175921749 GCAAACAAGGTGATGGCTCATGG - Intronic
984516858 4:180752199-180752221 GTAAACAAACTGTTCGTGCAGGG + Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
985961866 5:3308736-3308758 CCAAAAAAACTGATGGATCCAGG - Intergenic
987800491 5:22690197-22690219 ACAAACAAAAAGATGTTTCATGG - Intronic
991274368 5:64826569-64826591 TCAAAAAAACTGATTGATCAAGG - Intronic
992105032 5:73443445-73443467 GTAAACATACAGATGCTTCAGGG + Intergenic
993444968 5:88000602-88000624 GCATACAATCAGAAGGTTCAAGG + Intergenic
995225776 5:109699235-109699257 GTAAAAAAACTGATGGCTGAGGG - Intronic
997940503 5:138153140-138153162 GCAAACAAATTGAGGGGGCAGGG + Intronic
998449348 5:142222443-142222465 GCAAACCAACTGCTTGTTTAAGG - Intergenic
1005778909 6:29167509-29167531 GCCCAGAACCTGATGGTTCATGG + Intergenic
1013950393 6:115773629-115773651 GAGAACAAGCTTATGGTTCAAGG + Intergenic
1016166542 6:140952384-140952406 GCCAACAAACTGATGGGGCTTGG + Intergenic
1017188600 6:151627594-151627616 ACAAATAAACTGCTGGTCCATGG - Intergenic
1017380297 6:153820702-153820724 GTAAAAAATCTGATGGATCAGGG - Intergenic
1017617528 6:156260894-156260916 GCAAAGAAACTGATGTTCAAAGG - Intergenic
1020605978 7:10337493-10337515 TCAACCAAACTTTTGGTTCAGGG + Intergenic
1022180173 7:27911391-27911413 GCAAACTACCTGATGTCTCAAGG - Intronic
1022589103 7:31643839-31643861 GCCTACAGACTGAGGGTTCAGGG - Exonic
1023586599 7:41737483-41737505 GCAAAGAAACTGAGGGTTGGAGG - Intergenic
1024640636 7:51325816-51325838 TCCAAGAAACTGATGGTTCTGGG - Intergenic
1028602157 7:92613930-92613952 GCAAGCAAACAGGTGGTGCATGG + Exonic
1031068651 7:117136943-117136965 ACAAACAAACTGATGAGTCGAGG - Intronic
1034323607 7:150208473-150208495 TCAAACAATCTCATGATTCATGG + Intergenic
1034769589 7:153760714-153760736 TCAAACAATCTCATGATTCATGG - Intergenic
1051533437 9:18130787-18130809 GCAGAGAAAGTGATTGTTCACGG - Intergenic
1051556291 9:18386210-18386232 GAAAATATACTGTTGGTTCATGG + Intergenic
1052753714 9:32519301-32519323 GGAAACAAAATGATTATTCATGG - Intronic
1055587717 9:77772637-77772659 CCAACCAAACTCCTGGTTCAAGG + Intronic
1056956695 9:91088054-91088076 TCAAACAAACAAATGGATCATGG - Intergenic
1194709412 X:97216860-97216882 GCAAGCAAACAAATAGTTCAAGG - Intronic
1195007325 X:100698843-100698865 TAAAACAAACAGATGGTTTATGG + Intronic
1197174063 X:123466025-123466047 GCAACCAAACTGGTGGGTAAAGG - Intronic
1198971967 X:142292137-142292159 GCAAACAAATTCATGGTGTAGGG - Intergenic
1199474029 X:148226497-148226519 GCAAACAAGCTGATAGTTTTAGG + Intergenic
1201507000 Y:14712828-14712850 GCAAATAAACTCATGTGTCATGG + Intronic