ID: 975329571

View in Genome Browser
Species Human (GRCh38)
Location 4:73099089-73099111
Sequence CTGGAGAAGGAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4168
Summary {0: 2, 1: 7, 2: 91, 3: 659, 4: 3409}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975329553_975329571 30 Left 975329553 4:73099036-73099058 CCCGGAAAACCACCACAACTCCA 0: 2
1: 3
2: 2
3: 30
4: 260
Right 975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG 0: 2
1: 7
2: 91
3: 659
4: 3409
975329554_975329571 29 Left 975329554 4:73099037-73099059 CCGGAAAACCACCACAACTCCAG 0: 1
1: 4
2: 0
3: 13
4: 190
Right 975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG 0: 2
1: 7
2: 91
3: 659
4: 3409
975329563_975329571 -2 Left 975329563 4:73099068-73099090 CCAAGGGGCAGACCCAAAAAACT 0: 4
1: 2
2: 1
3: 8
4: 124
Right 975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG 0: 2
1: 7
2: 91
3: 659
4: 3409
975329557_975329571 21 Left 975329557 4:73099045-73099067 CCACCACAACTCCAGGAAGGAAA 0: 4
1: 2
2: 7
3: 39
4: 290
Right 975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG 0: 2
1: 7
2: 91
3: 659
4: 3409
975329562_975329571 10 Left 975329562 4:73099056-73099078 CCAGGAAGGAAACCAAGGGGCAG 0: 5
1: 1
2: 1
3: 41
4: 336
Right 975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG 0: 2
1: 7
2: 91
3: 659
4: 3409
975329558_975329571 18 Left 975329558 4:73099048-73099070 CCACAACTCCAGGAAGGAAACCA 0: 4
1: 2
2: 2
3: 25
4: 286
Right 975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG 0: 2
1: 7
2: 91
3: 659
4: 3409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975329571 Original CRISPR CTGGAGAAGGAGGAAGAGGA GGG Intronic
Too many off-targets to display for this crispr