ID: 975344810

View in Genome Browser
Species Human (GRCh38)
Location 4:73281782-73281804
Sequence CTGTAGCCAGAGCTTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975344810_975344817 25 Left 975344810 4:73281782-73281804 CCCTGCTCAAGCTCTGGCTACAG No data
Right 975344817 4:73281830-73281852 TGTGCTCGAACCCTGGAAATTGG No data
975344810_975344818 26 Left 975344810 4:73281782-73281804 CCCTGCTCAAGCTCTGGCTACAG No data
Right 975344818 4:73281831-73281853 GTGCTCGAACCCTGGAAATTGGG No data
975344810_975344816 18 Left 975344810 4:73281782-73281804 CCCTGCTCAAGCTCTGGCTACAG No data
Right 975344816 4:73281823-73281845 TGGACAGTGTGCTCGAACCCTGG No data
975344810_975344812 -2 Left 975344810 4:73281782-73281804 CCCTGCTCAAGCTCTGGCTACAG No data
Right 975344812 4:73281803-73281825 AGATCTCAGCTCAATACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975344810 Original CRISPR CTGTAGCCAGAGCTTGAGCA GGG (reversed) Intergenic
No off target data available for this crispr