ID: 975349854

View in Genome Browser
Species Human (GRCh38)
Location 4:73333133-73333155
Sequence TTATTAATGTCACCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975349853_975349854 9 Left 975349853 4:73333101-73333123 CCTTTCTTTGAGTTCTTTAAGCT No data
Right 975349854 4:73333133-73333155 TTATTAATGTCACCAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975349854 Original CRISPR TTATTAATGTCACCAAAACC AGG Intergenic
No off target data available for this crispr