ID: 975351211

View in Genome Browser
Species Human (GRCh38)
Location 4:73349586-73349608
Sequence GTTAATGGGAGCTACACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975351211_975351216 -2 Left 975351211 4:73349586-73349608 CCAATTGTGTAGCTCCCATTAAC No data
Right 975351216 4:73349607-73349629 ACATACCAAGAACCAGGTCTGGG No data
975351211_975351218 6 Left 975351211 4:73349586-73349608 CCAATTGTGTAGCTCCCATTAAC No data
Right 975351218 4:73349615-73349637 AGAACCAGGTCTGGGAACTTAGG No data
975351211_975351214 -8 Left 975351211 4:73349586-73349608 CCAATTGTGTAGCTCCCATTAAC No data
Right 975351214 4:73349601-73349623 CCATTAACATACCAAGAACCAGG No data
975351211_975351215 -3 Left 975351211 4:73349586-73349608 CCAATTGTGTAGCTCCCATTAAC No data
Right 975351215 4:73349606-73349628 AACATACCAAGAACCAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975351211 Original CRISPR GTTAATGGGAGCTACACAAT TGG (reversed) Intergenic
No off target data available for this crispr