ID: 975351214

View in Genome Browser
Species Human (GRCh38)
Location 4:73349601-73349623
Sequence CCATTAACATACCAAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975351211_975351214 -8 Left 975351211 4:73349586-73349608 CCAATTGTGTAGCTCCCATTAAC No data
Right 975351214 4:73349601-73349623 CCATTAACATACCAAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975351214 Original CRISPR CCATTAACATACCAAGAACC AGG Intergenic
No off target data available for this crispr