ID: 975355339

View in Genome Browser
Species Human (GRCh38)
Location 4:73396069-73396091
Sequence ATAAGCCAAATGGGTAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975355336_975355339 18 Left 975355336 4:73396028-73396050 CCGAAGCTATCAAATGCTATGGC No data
Right 975355339 4:73396069-73396091 ATAAGCCAAATGGGTAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975355339 Original CRISPR ATAAGCCAAATGGGTAAATT TGG Intergenic
No off target data available for this crispr