ID: 975362022

View in Genome Browser
Species Human (GRCh38)
Location 4:73481885-73481907
Sequence CAGCTAAAGCATGACCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975362020_975362022 19 Left 975362020 4:73481843-73481865 CCACACAACCTCGGGATATAGGT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
975362018_975362022 20 Left 975362018 4:73481842-73481864 CCCACACAACCTCGGGATATAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
975362013_975362022 30 Left 975362013 4:73481832-73481854 CCTAACCCTGCCCACACAACCTC 0: 1
1: 0
2: 1
3: 41
4: 422
Right 975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
975362016_975362022 25 Left 975362016 4:73481837-73481859 CCCTGCCCACACAACCTCGGGAT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
975362021_975362022 11 Left 975362021 4:73481851-73481873 CCTCGGGATATAGGTAAGAAATT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95
975362017_975362022 24 Left 975362017 4:73481838-73481860 CCTGCCCACACAACCTCGGGATA 0: 1
1: 0
2: 0
3: 7
4: 90
Right 975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975362022 Original CRISPR CAGCTAAAGCATGACCAGTT AGG Intronic
903104585 1:21064614-21064636 CAGCAAAACCTTGATCAGTTAGG + Intronic
903430301 1:23292892-23292914 CAGCAAAAGCTAGAACAGTTTGG + Intergenic
906445044 1:45889063-45889085 CAGATAAAGAAAGGCCAGTTAGG - Intronic
913680465 1:121184704-121184726 GAGCTAAGGCATGGCCAATTGGG - Intronic
917258431 1:173141218-173141240 GAGCTAAAGCCTGAACAGGTGGG - Intergenic
919168953 1:193929840-193929862 CAGCTATCCCATGACCACTTTGG + Intergenic
921759710 1:218899000-218899022 CACCTACAGCAGGACCAGCTGGG - Intergenic
921921236 1:220672569-220672591 CAGCAGTAGCATGACCAGTTTGG - Intergenic
923024997 1:230196962-230196984 CAGCCATATCATGATCAGTTAGG - Intronic
1070222328 10:74461178-74461200 CAGCTGAACCAAGACAAGTTAGG - Intronic
1071139290 10:82488723-82488745 CAGGGATGGCATGACCAGTTGGG + Intronic
1072185464 10:93033894-93033916 CAGCTAAAGGATAAAAAGTTAGG + Intronic
1074222142 10:111448469-111448491 CAGCTGATGCATGACCACATTGG - Intergenic
1077642529 11:3894591-3894613 CAACTAAAGCCTGACCAGCCAGG - Intronic
1079370656 11:19849325-19849347 CAGCTACAGCAGAACCAGTTAGG + Intronic
1080080406 11:28211154-28211176 CAGCTAATGCATAAGCTGTTGGG - Exonic
1080696833 11:34610015-34610037 CAGCTAATGATTCACCAGTTTGG - Intergenic
1081310085 11:41560213-41560235 CAGCAAAAGCATCCCTAGTTTGG + Intergenic
1085602221 11:77865167-77865189 AAACTAAACCATGACTAGTTAGG - Intronic
1092360873 12:7835184-7835206 CACCTACAGCCTGACCAGTATGG + Intronic
1098976537 12:76908247-76908269 CAGATAAAGCAAGACCTGCTGGG - Intergenic
1102193575 12:111007955-111007977 CAGCTGAAGCATGACATTTTAGG - Intergenic
1104743783 12:131197525-131197547 CAGCCAGAGCATCACCAGTGAGG + Intergenic
1105619837 13:22056118-22056140 TGGCTAAAACATGACCATTTGGG - Intergenic
1107846770 13:44522435-44522457 CAGATAAGGCAAGACCAGTAAGG + Intronic
1110697019 13:78502902-78502924 CCACTAAAGCATCACCACTTGGG - Intergenic
1110719119 13:78741673-78741695 AAGATAAAGTATGGCCAGTTTGG - Intergenic
1115307314 14:31945987-31946009 AAGCTTAGGCATGCCCAGTTTGG + Intronic
1118281813 14:64435783-64435805 CAGCTAAGGCATGACCAAGATGG + Intronic
1119173214 14:72550222-72550244 CAGCTAAAGAAAGCCCAGTCAGG + Intronic
1121240593 14:92427322-92427344 CAGCACAGGCATGACCAGTGTGG + Intronic
1122123116 14:99565135-99565157 AAACTAAAGCATGGCCACTTGGG + Intronic
1127511801 15:59649415-59649437 CACCTAGAGGATGACTAGTTAGG + Intronic
1133896369 16:9932999-9933021 AAGGTAAACCATGACCTGTTTGG - Intronic
1135202421 16:20450144-20450166 CTGCTAAAGCATGACCAAAAGGG + Intergenic
1135216683 16:20577722-20577744 CTGCTAAAGCATGACCAAAAGGG - Intergenic
1137701376 16:50500399-50500421 CAGCTACAGCATGAGCAGAAAGG - Intergenic
1139434530 16:66928403-66928425 CAGCTGTGGCATGAGCAGTTTGG + Intergenic
1141292723 16:82734973-82734995 CAGCTAAAGCAAGACTAATTAGG + Intronic
1141630342 16:85284196-85284218 CAGCTAAAGCACGACCCGCCGGG - Intergenic
1145019606 17:19419178-19419200 CAGGTAAAGTATCACCAGTTGGG + Intergenic
1146569580 17:33941100-33941122 CTGATGCAGCATGACCAGTTAGG + Intronic
1148810407 17:50286927-50286949 CAGCTAAAGTAAGACAAGGTTGG - Intergenic
1149543009 17:57482640-57482662 CATCTGAAGCATGAGAAGTTTGG + Intronic
1149982399 17:61321756-61321778 CAGCAGAAGCATGGCCAGATTGG - Intronic
1153195634 18:2592947-2592969 AAGCAAAAACCTGACCAGTTTGG + Intronic
1154412700 18:14149944-14149966 CAGCAAAAGGATGACCGGGTGGG + Intergenic
1156581239 18:38378734-38378756 CACCTAAAGCATGATCCATTGGG + Intergenic
1158730283 18:60015235-60015257 CAGGAAAAGCATCGCCAGTTCGG - Intergenic
1161840670 19:6678424-6678446 CAGCTGAACCTTGACCAGTCGGG + Exonic
1162888829 19:13717237-13717259 GAACTAAAGCATTAGCAGTTAGG + Intergenic
1165813228 19:38624994-38625016 CATCTAAAACATAACGAGTTAGG + Intronic
1166977159 19:46611394-46611416 CAGCCAAAACATGCCAAGTTTGG + Intergenic
925275748 2:2647002-2647024 CAGCTAAGACATGAGGAGTTGGG - Intergenic
926462857 2:13154678-13154700 CAGCTCAAACATCACCATTTTGG - Intergenic
927613366 2:24564943-24564965 CATCTAAAGGATGATCAGTAAGG - Intronic
928389998 2:30902250-30902272 CAGCCAAAGCAAGAGGAGTTGGG - Intergenic
936671099 2:114657376-114657398 AAGCTAAATTATGACTAGTTAGG - Intronic
937862251 2:126720328-126720350 CAGCTTCAGCATGTCCACTTGGG + Intergenic
939710662 2:145515328-145515350 CTTATAAAGCATGACTAGTTGGG + Intergenic
940718834 2:157259219-157259241 CAGTTAAAGCATGGTTAGTTTGG - Exonic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
1169934098 20:10864596-10864618 CAGCTCTGGCATGAGCAGTTGGG + Intergenic
1171015996 20:21542558-21542580 CAGCTAAACCATTTCTAGTTTGG - Intergenic
1176860306 21:14008311-14008333 CAGCAAAAGGATGACCGGGTGGG - Intergenic
1177117888 21:17107469-17107491 CAGCTAAAGCATGATAAATAGGG + Intergenic
1177348797 21:19907825-19907847 TAGCTAAAGAAAAACCAGTTAGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
952113222 3:30148801-30148823 CAGCCTAAGCATGAACTGTTAGG + Intergenic
953576025 3:44113870-44113892 CAGCTTAAGTATGTCCAGTGTGG - Intergenic
953794068 3:45969692-45969714 CAGCTCCAGCATGAGCAGCTTGG - Exonic
964441359 3:156714544-156714566 CAGCTAATGCATAAGCTGTTGGG + Intergenic
964643575 3:158934889-158934911 CAAATAAAGCCTGATCAGTTGGG - Intergenic
966877942 3:184334164-184334186 CAACTCAAGCATCACCTGTTCGG - Intronic
967748315 3:193084244-193084266 AAGCTATAGCCTGACCACTTTGG - Intergenic
970675203 4:18441021-18441043 TAGCCAAAGCATGACCTGTCTGG + Intergenic
975362022 4:73481885-73481907 CAGCTAAAGCATGACCAGTTAGG + Intronic
981972572 4:150682967-150682989 CAACAACAGCATGTCCAGTTTGG + Intronic
992732652 5:79688963-79688985 CAGGTAAAACATGGCCTGTTAGG + Intergenic
992769892 5:80036723-80036745 AAGCTCACGCCTGACCAGTTAGG - Intronic
998987924 5:147782675-147782697 CAGCAGCAGCATCACCAGTTGGG + Exonic
1000301841 5:159963787-159963809 CAGCTTAAGGATGACCTGCTGGG + Intronic
1008703070 6:54124848-54124870 CAGCAAAAGCATGGGCAGGTAGG + Exonic
1014539706 6:122660432-122660454 AGGCTACAGCATGATCAGTTTGG - Intronic
1024341246 7:48263410-48263432 CAGATAAAGCATGAACTGTTTGG + Intronic
1029471605 7:100758307-100758329 CAGCTTAAGAATGGCCAGTATGG + Exonic
1030554360 7:111004758-111004780 CAGAAAAATCATGCCCAGTTAGG - Intronic
1031278164 7:119758938-119758960 CAGCAAAAGCCTGATCAGATAGG - Intergenic
1032010421 7:128343526-128343548 CATCTAAAGCAGAATCAGTTTGG + Intronic
1033109858 7:138564258-138564280 TAGCCCAAGCATGACCAGATTGG + Intronic
1035071788 7:156150292-156150314 CAGCTTGAGCATGTACAGTTTGG - Intergenic
1042015751 8:64308624-64308646 AAGGTAAAGCATGACTATTTGGG + Intergenic
1044594270 8:93942796-93942818 CAGCTAAAGCATATTCAGTGTGG + Intergenic
1047136064 8:122079692-122079714 CAGCTGTACCATGACCATTTTGG - Intergenic
1056401318 9:86230182-86230204 CAGTTGAAGCATGACAAATTTGG - Intronic
1059777482 9:117489905-117489927 AAGCTGAAGCATGACAAGTAGGG - Intergenic
1186926398 X:14337276-14337298 CAGCCATAGCATGCCCAGTGAGG - Intergenic
1192015809 X:67329420-67329442 CAGCAAAAGCAGAACCAGTATGG - Intergenic
1194107807 X:89793055-89793077 AAGCTAAAGCTGGAGCAGTTCGG + Intergenic
1194464813 X:94220429-94220451 CAGAAAAAGAATGACCAGTCAGG - Intergenic
1200459764 Y:3440840-3440862 AAGCTAAAGCTGGAGCAGTTCGG + Intergenic
1201488370 Y:14514349-14514371 GTGAAAAAGCATGACCAGTTAGG + Intergenic