ID: 975365058

View in Genome Browser
Species Human (GRCh38)
Location 4:73519501-73519523
Sequence TGCCCACCAGAACTGCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975365058_975365059 -10 Left 975365058 4:73519501-73519523 CCTTTTAGCAGTTCTGGTGGGCA No data
Right 975365059 4:73519514-73519536 CTGGTGGGCATTTGTTTTTCTGG No data
975365058_975365060 -9 Left 975365058 4:73519501-73519523 CCTTTTAGCAGTTCTGGTGGGCA No data
Right 975365060 4:73519515-73519537 TGGTGGGCATTTGTTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975365058 Original CRISPR TGCCCACCAGAACTGCTAAA AGG (reversed) Intergenic
No off target data available for this crispr