ID: 975365583

View in Genome Browser
Species Human (GRCh38)
Location 4:73524212-73524234
Sequence GACGGAAACTTGCTGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975365583_975365592 19 Left 975365583 4:73524212-73524234 CCTGAAACCAGCAAGTTTCCGTC No data
Right 975365592 4:73524254-73524276 TACTACCTGGGTAATATTGCTGG No data
975365583_975365595 29 Left 975365583 4:73524212-73524234 CCTGAAACCAGCAAGTTTCCGTC No data
Right 975365595 4:73524264-73524286 GTAATATTGCTGGTTATTCAGGG No data
975365583_975365586 -6 Left 975365583 4:73524212-73524234 CCTGAAACCAGCAAGTTTCCGTC No data
Right 975365586 4:73524229-73524251 TCCGTCTCACCCAAGGCTAATGG No data
975365583_975365590 6 Left 975365583 4:73524212-73524234 CCTGAAACCAGCAAGTTTCCGTC No data
Right 975365590 4:73524241-73524263 AAGGCTAATGGCATACTACCTGG No data
975365583_975365594 28 Left 975365583 4:73524212-73524234 CCTGAAACCAGCAAGTTTCCGTC No data
Right 975365594 4:73524263-73524285 GGTAATATTGCTGGTTATTCAGG No data
975365583_975365591 7 Left 975365583 4:73524212-73524234 CCTGAAACCAGCAAGTTTCCGTC No data
Right 975365591 4:73524242-73524264 AGGCTAATGGCATACTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975365583 Original CRISPR GACGGAAACTTGCTGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr