ID: 975365698

View in Genome Browser
Species Human (GRCh38)
Location 4:73524944-73524966
Sequence CCTTCCTAGCAGCGGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975365698_975365704 -3 Left 975365698 4:73524944-73524966 CCATGCAGCCGCTGCTAGGAAGG No data
Right 975365704 4:73524964-73524986 AGGTAGGAAAGGAGTGGCAATGG No data
975365698_975365703 -9 Left 975365698 4:73524944-73524966 CCATGCAGCCGCTGCTAGGAAGG No data
Right 975365703 4:73524958-73524980 CTAGGAAGGTAGGAAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975365698 Original CRISPR CCTTCCTAGCAGCGGCTGCA TGG (reversed) Intergenic
No off target data available for this crispr