ID: 975366058

View in Genome Browser
Species Human (GRCh38)
Location 4:73529152-73529174
Sequence GTGTTTCAACAAATAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975366058_975366059 1 Left 975366058 4:73529152-73529174 CCATGCTCTATTTGTTGAAACAC No data
Right 975366059 4:73529176-73529198 GTAAAACATCATCAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975366058 Original CRISPR GTGTTTCAACAAATAGAGCA TGG (reversed) Intergenic
No off target data available for this crispr