ID: 975369548

View in Genome Browser
Species Human (GRCh38)
Location 4:73568640-73568662
Sequence TTGTGCTTGAGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975369548_975369556 24 Left 975369548 4:73568640-73568662 CCTTCTTCCCTCCTCAAGCACAA No data
Right 975369556 4:73568687-73568709 AAGCTGTGCAGCCTATGGTTGGG No data
975369548_975369555 23 Left 975369548 4:73568640-73568662 CCTTCTTCCCTCCTCAAGCACAA No data
Right 975369555 4:73568686-73568708 TAAGCTGTGCAGCCTATGGTTGG No data
975369548_975369554 19 Left 975369548 4:73568640-73568662 CCTTCTTCCCTCCTCAAGCACAA No data
Right 975369554 4:73568682-73568704 GTTGTAAGCTGTGCAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975369548 Original CRISPR TTGTGCTTGAGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr