ID: 975370015

View in Genome Browser
Species Human (GRCh38)
Location 4:73574275-73574297
Sequence CTGTTGGGATTAGGAGCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975370015_975370024 23 Left 975370015 4:73574275-73574297 CCTCCGGCTCCTAATCCCAACAG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 975370024 4:73574321-73574343 CCTTCTTTGTGCTTACCCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975370015 Original CRISPR CTGTTGGGATTAGGAGCCGG AGG (reversed) Exonic
904762652 1:32817139-32817161 CGTTGGGGATTAGGAGCCCGAGG - Intronic
908122484 1:60999353-60999375 CTGGTGGAACTAGGAGCAGGTGG + Intronic
911156072 1:94638129-94638151 GTGGTGGTATTAGGAGCTGGGGG + Intergenic
915993025 1:160536219-160536241 CTGTTGGGATGAGGAGGGGATGG + Intergenic
916981645 1:170144422-170144444 GTGTTGGGATTTGGAGATGGGGG + Intergenic
920974047 1:210769005-210769027 GTGTTGGAATTAGGAGTCGGGGG - Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
922784316 1:228275608-228275630 CTGTTTGGATTGGGATCCCGGGG + Intronic
1063230711 10:4063277-4063299 CTGTGGGGAGTGGGAGCAGGGGG + Intergenic
1066656838 10:37704730-37704752 CTGTGGGCATTGGGAGCCTGTGG - Intergenic
1067041368 10:42954968-42954990 CTGTAGGCATTGGGAGCCTGTGG - Intergenic
1069751386 10:70747460-70747482 GTGCTGGAATTAGGGGCCGGGGG + Intronic
1071564190 10:86663140-86663162 GTGGTGGGAACAGGAGCCGGTGG - Intronic
1072235703 10:93451594-93451616 CTGTTGGGATTAAAAGGCGAAGG + Intronic
1074129295 10:110559079-110559101 CTGAAGTGAGTAGGAGCCGGTGG - Intergenic
1075595641 10:123727239-123727261 ATGGTGGGATTAGGAGACAGAGG - Intronic
1076700743 10:132271416-132271438 CTGTTGGGACAAGGAGCTGGGGG - Intronic
1080178399 11:29394200-29394222 CTGTTGGCATGAGGAACCTGGGG + Intergenic
1081752609 11:45522691-45522713 CTGGTAGGAGTAGGAGCAGGTGG + Intergenic
1083911590 11:65713111-65713133 CTGTTGGCATTAGGAGCTCCTGG + Intronic
1092181999 12:6452417-6452439 CTGTTGGGCTTAGAAGGCGATGG - Intronic
1096086296 12:48867290-48867312 ATTTTGGGATTAGAAGCTGGAGG + Intergenic
1099327155 12:81231871-81231893 CTGTTGGGGTTAGGCGGTGGGGG - Intronic
1100627649 12:96352411-96352433 CTGTTGGCATTTGGAGCAGCTGG - Intronic
1104672247 12:130688789-130688811 CAGTTGGAATTGGGGGCCGGAGG - Intronic
1104839747 12:131817473-131817495 CTGTTGGGATGATGAGCGGACGG - Intergenic
1106503922 13:30355348-30355370 CTGGTGGGGTTAGCAGCCGGTGG - Intergenic
1109274152 13:60285798-60285820 CTGTTGGGATGGGGTGCAGGGGG + Intergenic
1110828251 13:79998209-79998231 CTGTTGGGTTTAAGAGTCAGTGG - Intergenic
1113470052 13:110537906-110537928 TTGTTGGGAATAGGAGCCCTGGG - Intronic
1114004785 14:18300795-18300817 GTGGTGGGGTTAGGAGGCGGGGG - Intergenic
1128559398 15:68654817-68654839 TTGGTGGGATTTGGAGCCTGTGG + Intronic
1132709999 16:1262287-1262309 CTGTGGGGAAAAGCAGCCGGAGG + Intergenic
1133081921 16:3328667-3328689 TTGTTGGGATAAGGAGAGGGAGG - Intergenic
1140228902 16:73101068-73101090 CTGATGGGATTTGGAACAGGTGG - Intergenic
1142246587 16:88973037-88973059 CTGCTGGGCTTTGGAGCTGGTGG - Intronic
1143223630 17:5282282-5282304 CTGTCAGGATGAGGAGGCGGAGG + Exonic
1150271589 17:63869460-63869482 TGGTTGGAATTAGGAGCAGGTGG + Intergenic
1150275125 17:63892340-63892362 TGGTTGGAATTAGGAGCAGGTGG + Intergenic
1150277263 17:63907102-63907124 TGGTTGGAATTAGGAGCAGGTGG + Intergenic
1151365890 17:73616310-73616332 CTGTTGAGGTGGGGAGCCGGGGG - Intronic
1151699984 17:75737786-75737808 CTGTTGGGATGGGGACCCTGGGG - Intronic
1152343823 17:79739606-79739628 CTGTTGGGGACAGGAGTCGGGGG + Intronic
1153316585 18:3728802-3728824 TTATTGGGAGTAGGAGCTGGCGG + Intronic
1153743341 18:8151777-8151799 CTGGTGGGGTTAGGCGCCAGAGG + Intronic
1159568977 18:70090649-70090671 GTGGTGGGATTAGCAGCCTGGGG - Intronic
1159939571 18:74396486-74396508 CTGTAGAAATTAGGAGCCTGGGG + Intergenic
1160097349 18:75887173-75887195 CTGTTGGGGCTGGGAGCAGGAGG - Intergenic
1162690475 19:12425888-12425910 CTGTTGAGCTTAGGAGTCGGAGG + Intronic
1166758768 19:45211917-45211939 CCGTGGGGACTAGGATCCGGCGG + Intronic
925097279 2:1217000-1217022 CTGTGGGGAATATGAGCAGGGGG + Intronic
931028004 2:58135284-58135306 CTGATGGGAATAGGAGCAAGTGG - Intronic
932137749 2:69245420-69245442 CTGTTGGGAGGTGGAGCCTGGGG - Exonic
933804541 2:85988615-85988637 GTGTTGGGCTTTGGAGCCAGAGG - Intergenic
946132349 2:217616562-217616584 ATGTTGGGGTTAGGATCCTGGGG - Intronic
948372812 2:237500999-237501021 CTGTGGGGGTTATGAGCCGGGGG - Intronic
1169272479 20:4211213-4211235 CTGTAGGGAATAGAAGCCAGTGG + Intergenic
1172510804 20:35499661-35499683 CTGTTGGAACTAGGAGGAGGGGG + Intronic
1175411499 20:58772704-58772726 CTGTTGGGATTTGGGGAGGGTGG + Intergenic
1175790489 20:61737397-61737419 CTCTTGGGATTCTGAGCCTGTGG - Intronic
1177319223 21:19498726-19498748 CTGTGGGTAATAGGAGACGGTGG - Intergenic
1178263443 21:31120797-31120819 CTCTTGGGAGGAGGAGGCGGCGG - Exonic
1178505848 21:33162519-33162541 CTGGTGGGATTCGGAGGCAGGGG - Intergenic
1178817971 21:35949003-35949025 CAGCTGGGAGTAGGAGCAGGAGG - Intronic
1180037738 21:45258331-45258353 CTGTTGAGCTCAGGGGCCGGTGG - Intergenic
1181104963 22:20568712-20568734 CTGGTTGGATTAGGGGCTGGGGG + Intronic
1184907653 22:47499647-47499669 CTGATGGGAATAGGAGCAGAGGG + Intergenic
1185221924 22:49633312-49633334 CTGTGGGCAGTGGGAGCCGGTGG - Intronic
1185346383 22:50312626-50312648 CTGTGGGGATTAACAGGCGGGGG + Intronic
959760246 3:109954195-109954217 CTGTTGTGATTAGGGGAGGGAGG - Intergenic
962768663 3:138592543-138592565 TTGTTGGGGGTAGGAGTCGGGGG + Intronic
969637239 4:8376535-8376557 CTGCTGGGATCAGGAGCCTCGGG + Intronic
972151586 4:36098126-36098148 CTGTTGGAATTTGGGGCTGGTGG - Intronic
973531363 4:51839807-51839829 GTGTTGGGATTGGGAGTAGGAGG - Intergenic
974131163 4:57757573-57757595 CTGTTGGGGGTAGGAGCTAGGGG + Intergenic
975370015 4:73574275-73574297 CTGTTGGGATTAGGAGCCGGAGG - Exonic
979251006 4:118566432-118566454 CTGTTTGGATTAGGATCCCCAGG + Intergenic
979458323 4:120951490-120951512 TTGATGGGATTAGGAGGTGGGGG - Intergenic
981686514 4:147460606-147460628 GTGATGGTATTAGGAGTCGGAGG + Intergenic
982117406 4:152109103-152109125 CTGTTAGGATGAGGAGCCCCTGG + Intergenic
990271891 5:54151023-54151045 CTGTGGTCATTTGGAGCCGGAGG - Intronic
1000793454 5:165634880-165634902 CTGGTGGGGTTAGGAGCAGGTGG + Intergenic
1006188852 6:32195729-32195751 CTCTCGGGAGTAGGAGCAGGAGG - Exonic
1007358336 6:41336549-41336571 CTGTTGGGAACAGGTGCAGGGGG + Intronic
1008714017 6:54266504-54266526 CTGTTGGGATTCGGTGCTGCTGG + Intergenic
1016994873 6:149954595-149954617 CTGTTGGGGTGAGGAGCACGAGG - Intergenic
1018538975 6:164856298-164856320 CTGCTAGGATTGGGAGCTGGTGG - Intergenic
1019575883 7:1737414-1737436 CTGCTGGGATTCAGAGCCAGGGG - Intronic
1026946482 7:74319422-74319444 CGGTTGGACTTAGGAGGCGGAGG + Intronic
1032794328 7:135265652-135265674 CTGATGGTATTAGGAGGTGGGGG + Intergenic
1034462553 7:151205900-151205922 CTGTGGGGCTCAGGAGGCGGGGG - Intergenic
1035332761 7:158107154-158107176 CTGATGGGATCAGGAGATGGAGG - Intronic
1036398084 8:8385888-8385910 CTGCTGGGACCAGGACCCGGGGG - Intronic
1040617687 8:49055194-49055216 CTGTAGCAATTAGGAGCAGGAGG - Intronic
1041476741 8:58275845-58275867 CTGTTAGGATGGGGAGCCTGAGG + Intergenic
1045847792 8:106658050-106658072 CTGTTGGGGTTCGGGGGCGGCGG + Intronic
1046778451 8:118189192-118189214 CTGGTGGGATTTGGTGCTGGGGG + Intergenic
1053430506 9:38038929-38038951 CGGGTGGGATCAGGAGCCCGAGG + Intronic
1056234841 9:84584622-84584644 CTGTGGGCATTTGGAGCTGGGGG + Intergenic
1057135078 9:92681823-92681845 GTGATGGTATTAGGAGACGGGGG - Intergenic
1058526826 9:105867380-105867402 CTGTTGGGGTGGGGAGCCTGAGG - Intergenic
1190334458 X:49253865-49253887 CTGTCAGGATTAGGAGCTTGGGG + Intronic
1194622648 X:96192172-96192194 CTATTGGAATTAGGAGGTGGGGG - Intergenic