ID: 975370265

View in Genome Browser
Species Human (GRCh38)
Location 4:73577973-73577995
Sequence TCTGGAAAACAGAGATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975370265_975370268 -7 Left 975370265 4:73577973-73577995 CCCACCTATCTCTGTTTTCCAGA 0: 1
1: 0
2: 4
3: 32
4: 299
Right 975370268 4:73577989-73578011 TTCCAGATTACTGCCCAAACAGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975370265 Original CRISPR TCTGGAAAACAGAGATAGGT GGG (reversed) Intronic
900749673 1:4387477-4387499 TCTGGAGAACAGTCATAGATAGG - Intergenic
904887581 1:33752655-33752677 ACTGGGTAACAGGGATAGGTTGG + Intronic
904971835 1:34425387-34425409 TCTGAAACACAGAGAGAGATGGG + Intergenic
905307098 1:37027379-37027401 TCTGGAGCACAAAGATAAGTGGG + Intronic
906048637 1:42852423-42852445 TGGGGAAAACAGAGGCAGGTTGG - Exonic
906568374 1:46816314-46816336 TCAGGCAAAGAGAGAGAGGTAGG + Intronic
906818754 1:48906611-48906633 CCTGGAAAACAGAGAAATGCTGG + Intronic
907081569 1:51628173-51628195 TCTCCAAAACACAGATAAGTAGG - Intronic
908699209 1:66880301-66880323 ACTGGATAACAGACAGAGGTTGG + Intronic
909029988 1:70528430-70528452 TCTGGAAAAGGGAGAGGGGTTGG + Intergenic
909229533 1:73068255-73068277 CCTGGAAAACAGAGCTACTTAGG - Intergenic
909414446 1:75388897-75388919 TCTTGAAGACAGAGAAAGGTTGG - Intronic
910772384 1:90843122-90843144 TCAGGAAATCAGAGGTAGGTTGG + Intergenic
911398943 1:97350104-97350126 GCTGGGAAACAGATAGAGGTAGG + Intronic
913404302 1:118472277-118472299 TCAGTAAAGAAGAGATAGGTAGG - Intergenic
914203649 1:145507699-145507721 TATGGAAAACATTGAGAGGTGGG + Intergenic
914482771 1:148080853-148080875 TATGGAAAACATTGAGAGGTGGG + Intergenic
916125015 1:161561904-161561926 ACTGGAGAAGAGAGAAAGGTTGG + Intergenic
916134907 1:161643250-161643272 ACTGGAGAAGAGAGAAAGGTTGG + Intronic
916476435 1:165173818-165173840 ATTGGAAAACAGAAATAGGGAGG + Intergenic
916638544 1:166700794-166700816 TCTGGAGAACGCAGATAGCTGGG - Intergenic
917710575 1:177680157-177680179 GTTGGAAAACAGAGATAAGCAGG - Intergenic
919385685 1:196920415-196920437 ACTGGGAAACAGACAGAGGTTGG + Intronic
921910659 1:220545680-220545702 TTTGGGAGACAGAGATAGGGTGG - Intronic
923114535 1:230922667-230922689 AATGGAAAACAGAGAGAGGTGGG - Intronic
923258938 1:232248099-232248121 GTTGGAAAAGAGAGATAGATGGG + Intergenic
923557131 1:235010037-235010059 TCTGGAAAACAGAGAATGAGAGG + Intergenic
924173166 1:241362332-241362354 TGTTGAGAACAGACATAGGTGGG - Intergenic
924710103 1:246524297-246524319 TCTGGAACACAGAGGCAGGCTGG + Intergenic
1064807911 10:19158431-19158453 AGTTGAAACCAGAGATAGGTTGG + Intronic
1064828527 10:19434006-19434028 CCTGGAAAACAGAGAAAGACTGG + Intronic
1069679111 10:70271032-70271054 AATGTAAAACAGAGATAGCTAGG - Intronic
1070912916 10:80133569-80133591 TCTGGGAAACTGAGCTATGTTGG + Intronic
1071189661 10:83084329-83084351 TCTGGAAAACACACTTTGGTGGG + Intergenic
1071228877 10:83562970-83562992 TCTGGAAAGCTGTGCTAGGTAGG + Intergenic
1071847236 10:89533930-89533952 CTTGGAAAACTGAGTTAGGTGGG + Intronic
1073402054 10:103265798-103265820 TCTGGGAAACAGCAAAAGGTAGG + Intergenic
1073454649 10:103629197-103629219 TCTGGATCACAGAAAAAGGTAGG + Intronic
1073531729 10:104238640-104238662 ACAGGAAAACAGAAAAAGGTCGG - Intronic
1073601624 10:104851619-104851641 TGTGTAAAACTGTGATAGGTGGG + Intronic
1073682434 10:105718866-105718888 TCTGGAAAAAAGAAATGGGTAGG - Intergenic
1073736279 10:106350803-106350825 TCAGGAGAATAGAGATAGGCAGG - Intergenic
1073991064 10:109262516-109262538 TCTGGAAAACAGGCAGAAGTTGG - Intergenic
1074120591 10:110491281-110491303 TCTGGAAAACAGACATTGTAAGG + Intergenic
1074160839 10:110835186-110835208 TCTGGAAAACAGAGTTGTTTTGG + Intronic
1075736567 10:124668000-124668022 TCTGGGCTCCAGAGATAGGTGGG - Intronic
1077262631 11:1630957-1630979 TCTGGGAATGAGAGAGAGGTGGG - Intergenic
1078127625 11:8583884-8583906 TCTGTAAAACAGAGATAATATGG + Intronic
1078865283 11:15291590-15291612 TCTGGTTAACTGAGATACGTTGG + Intergenic
1080208971 11:29763054-29763076 TCTTTAAAACAGAGATTTGTAGG + Intergenic
1080764548 11:35283092-35283114 TGAGGAAAACACAGATAGGATGG + Intronic
1081276903 11:41161327-41161349 TCAGGAAAACAGAAATAAGCAGG - Intronic
1083907987 11:65686540-65686562 TCTGGAAAACAGAGATTGTTTGG + Intergenic
1086455713 11:86956497-86956519 ACTGGAAAGCAGAGAGAGGGTGG - Intergenic
1086980493 11:93192105-93192127 TAAGTAAAACAGAGATAAGTTGG + Intronic
1090480061 11:127060007-127060029 TGTGGGAGACAGAGATGGGTAGG + Intergenic
1092336255 12:7636638-7636660 TATGGAAAACAGATATAGTGGGG - Intergenic
1092702980 12:11253708-11253730 TTTGAAAGACAGAGATAGGGTGG + Intergenic
1092759579 12:11797510-11797532 ACTGGAAGACAGAGCTGGGTAGG + Intronic
1095551986 12:43453525-43453547 TCTGGATAACATATATAGTTTGG - Intronic
1097793600 12:63840637-63840659 TCTAAAAATCAGAGATAGGCTGG - Intergenic
1098461720 12:70739798-70739820 TCTGGAGACTAGAGATCGGTAGG + Intronic
1098791953 12:74835866-74835888 ACTGGATAACAGACAGAGGTTGG + Intergenic
1099944750 12:89231831-89231853 TCTGTAAAATGGAGATAGCTGGG + Intergenic
1100025558 12:90123327-90123349 GCTGGAAAAGATAGATATGTAGG + Intergenic
1100480230 12:94970758-94970780 TCTGGAATGCAGAGAGATGTGGG + Intronic
1100780695 12:98023102-98023124 GTTGGCAAACAGAGAGAGGTTGG - Intergenic
1101205642 12:102484324-102484346 TAGGGAAAACAGAAATAGGGAGG + Intergenic
1101212138 12:102545094-102545116 TCTAGAACACAGGGATAGGGAGG + Intergenic
1104260849 12:127180733-127180755 TTTGGAAAACAGAGGCAGGGGGG - Intergenic
1104497612 12:129255691-129255713 TCTGTAGAACAGAGATGGGATGG - Intronic
1105633804 13:22198052-22198074 TCTGGGGAACACAGACAGGTGGG - Intergenic
1105710769 13:23006963-23006985 TCTGGAAAAGAGAGATCTGCAGG - Intergenic
1106501756 13:30335688-30335710 CCTGGAATGCAGAGTTAGGTGGG + Intergenic
1109903794 13:68810592-68810614 TGTGTAAAAGAGAGATAAGTGGG - Intergenic
1110077941 13:71273845-71273867 TCTGGAAAACAAAGTTATTTGGG - Intergenic
1110850508 13:80239508-80239530 TTTGGCAAACAGAAATAGGTTGG + Intergenic
1110955422 13:81547242-81547264 TCTGGATAACAGGAAGAGGTTGG - Intergenic
1111211506 13:85085492-85085514 TCTGGAACAGAGAAATAAGTAGG - Intergenic
1111392857 13:87621763-87621785 CCTGAAAATCAGAGATATGTTGG - Intergenic
1114043912 14:18704947-18704969 TCTGGAAAACAAAGTTGGGTTGG - Intergenic
1114048196 14:18895399-18895421 TCTGGAAAACAAAGTTGGGTTGG - Intergenic
1114114321 14:19506247-19506269 TCTGGAAAACAAAGTTGGGTTGG + Intergenic
1114116017 14:19623999-19624021 TCTGGAAAACAAAGTTGGGTTGG + Intergenic
1114173774 14:20300565-20300587 TTTGGAAAGCAGAGATGGGAAGG - Intronic
1115091824 14:29586250-29586272 TCTGGAATGCAGAGATAGAAGGG + Intronic
1116786357 14:49293267-49293289 TCTGCATTACAGAGTTAGGTGGG - Intergenic
1119184018 14:72624640-72624662 CCTGGTAAAGAGACATAGGTTGG - Intronic
1119198020 14:72731934-72731956 TCTGAAAAACAAAGATAGAAAGG + Exonic
1120591841 14:86384605-86384627 TCTGGAACACAGAGCTGGGATGG - Intergenic
1124032547 15:26024606-26024628 TTTGGTAAACAGAGAAAAGTGGG + Intergenic
1125172097 15:36777438-36777460 TCTGAAAAACAGGGAGAGGGAGG - Intronic
1127853305 15:62934281-62934303 TCTGGAAAAAGGAGAGAGGATGG - Intergenic
1127976305 15:63999692-63999714 TCTGGCAAGCAGAGCTAGGGTGG - Intronic
1129084630 15:73075857-73075879 TCTGGAAAAGAGAGGAAGGAAGG - Intronic
1129171361 15:73810149-73810171 GCAGGAAAACAGACATAGGCAGG - Intergenic
1130785632 15:87092720-87092742 TCTGAACGACAGGGATAGGTGGG + Intergenic
1130807669 15:87343182-87343204 TCTAGAAAACAGAGATTTGGAGG + Intergenic
1131368399 15:91859343-91859365 TCTGGAAAACAGATATAAACAGG + Intronic
1131681452 15:94728194-94728216 TCTGCAGACCAGGGATAGGTAGG - Intergenic
1132623375 16:878787-878809 TCTGGAAAACAGATGTACCTGGG - Intronic
1133478198 16:6143988-6144010 CCTGGACAACATAGGTAGGTAGG - Intronic
1133683371 16:8142258-8142280 TCTGGAAAAGGCAGATATGTAGG + Intergenic
1134335022 16:13290671-13290693 GCTGGAAACCAGAGAGAGGGAGG - Intergenic
1136237357 16:28922935-28922957 GCTGGAAAACAGCCAAAGGTTGG - Intronic
1137233545 16:46592813-46592835 ACTGGAAAACAGAAAATGGTGGG - Intronic
1139234929 16:65327807-65327829 TCTTGAAAACAAAGATATATAGG + Intergenic
1139818946 16:69703908-69703930 TCTGGAAGAGAGAGAAAGGAAGG - Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140328902 16:74033190-74033212 TCTGGAAAAGAGTTATATGTTGG + Intergenic
1141367240 16:83455174-83455196 TCTGAAAGTCAGAGATACGTGGG - Intronic
1144289562 17:13813500-13813522 TGTGGAACACAGTGAGAGGTGGG + Intergenic
1144649080 17:16996185-16996207 TATGAAAAACAGGGATGGGTGGG - Intergenic
1146558377 17:33847130-33847152 TCTGGAAAACAGAGACTTCTGGG + Intronic
1146889012 17:36492886-36492908 TGTGGAAAACAAAGGTGGGTTGG + Exonic
1147609444 17:41793045-41793067 ACAAGAAAACAGAGATAGGACGG + Intergenic
1147997245 17:44367133-44367155 TGTTGAAAACAGAGAGAGGCTGG - Intergenic
1148639497 17:49175826-49175848 TCTGGAAAAGAAAGATCTGTAGG + Intergenic
1148783766 17:50135384-50135406 TCTGGAAAACAAAGGAGGGTAGG + Exonic
1149291936 17:55225861-55225883 TCTGGAAAATAGAGCTCTGTCGG - Intergenic
1149664508 17:58356441-58356463 AATGGAAAAGAGAGATATGTGGG + Intronic
1151394913 17:73816606-73816628 TCTGGAAAGTAGATATAGTTTGG - Intergenic
1151495482 17:74455603-74455625 TATGGAAAAGAGAGAAAGGAAGG - Intergenic
1152537594 17:80959697-80959719 TTTAGGAAACAGAGAGAGGTTGG + Intronic
1152746656 17:82043475-82043497 TCTGGAAAGCAACCATAGGTGGG + Intergenic
1152823178 17:82447514-82447536 TTTGGAAAACAGAGAAAAGAAGG - Intronic
1153987938 18:10369300-10369322 TCTGGTAAACACAGAAAGCTTGG + Intergenic
1154182911 18:12152780-12152802 TCTTGCAAACAGGGATAGTTTGG - Intergenic
1154957141 18:21269854-21269876 TCTAGAGATCAGAAATAGGTAGG + Intronic
1155354712 18:24941134-24941156 TCTGGGAACCAGAAATAGGAGGG - Intergenic
1155642533 18:28036690-28036712 TCAGCAAAACAGAGATTGGGTGG + Intronic
1156507485 18:37607542-37607564 TCTGGAAAACAGTGATACATGGG + Intergenic
1156884048 18:42113486-42113508 TCTGTAAAACAGAGATAGGCAGG - Intergenic
1157729017 18:49987829-49987851 TCTGGAAGGCAGAGATGGGGAGG + Intronic
1161634176 19:5376948-5376970 GGTGGAAAAAAGTGATAGGTTGG + Intergenic
1162199848 19:9011989-9012011 GCTGGAAATGAGAGGTAGGTGGG + Intergenic
1162504655 19:11076064-11076086 TCTGGGGAACAGAGTTAGGTCGG + Intergenic
1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG + Intronic
1164936819 19:32221155-32221177 GCTGGAAGACAGAGAGAGGCCGG - Intergenic
1165753421 19:38276173-38276195 TCTAGAAAAAACAGATGGGTGGG + Intronic
1166142958 19:40815177-40815199 CCTGGAAAACAGAGACCGGGAGG - Intronic
1166184601 19:41131644-41131666 CCTGGAAAACAGAGACCGGGAGG + Intergenic
1168487544 19:56777216-56777238 TCAGGAAAAGAGGGATAGCTGGG + Intronic
925740989 2:7006108-7006130 TCTGGGTAACAGAGATTGTTGGG - Intronic
925749729 2:7077046-7077068 TCTAGAAGACAGAGAAAGATGGG + Intergenic
926194442 2:10754053-10754075 CCTGGCAAACGGAGGTAGGTAGG + Exonic
927194236 2:20536906-20536928 TCTGGAAAGATGAGACAGGTGGG + Intergenic
927339766 2:21969488-21969510 TCTGGAAGAGAGAGAGTGGTTGG - Intergenic
927736694 2:25530066-25530088 TATGAAAAACAGGGATGGGTTGG + Intronic
931096024 2:58942213-58942235 ACTGGGTAACAGACATAGGTTGG + Intergenic
933498578 2:83083517-83083539 AATGGAAAACAGAGATAGTGGGG - Intergenic
935092044 2:99904810-99904832 TCTGCAAAACTAACATAGGTGGG + Intronic
935638422 2:105268589-105268611 GCTGGGAAGCAGAGAGAGGTGGG + Intronic
935857027 2:107285998-107286020 TCTCAAGAGCAGAGATAGGTAGG - Intergenic
936669588 2:114641281-114641303 TCAGGAAAAAAGACAAAGGTCGG - Intronic
936858978 2:116993452-116993474 TCTGGAAGACAGAGATAAATGGG - Intergenic
937482716 2:122278941-122278963 TCAGGAAAAAAGAGAAAGATGGG - Intergenic
938374361 2:130796103-130796125 TCTGGAGAGCAGGGACAGGTGGG - Intergenic
938425565 2:131183914-131183936 TCTGGAAAACAAAGTTGGGTTGG - Intronic
938786179 2:134632066-134632088 TCTGGAAATCAGAGATACCATGG + Intronic
939617837 2:144380334-144380356 CCTGGAAAACAGAAATTGTTTGG - Intergenic
939691353 2:145265694-145265716 TCTGGAAGACAGAAAATGGTGGG - Intergenic
940502386 2:154509300-154509322 TCTAGAACACAGAGATGGCTAGG + Intergenic
941353016 2:164459128-164459150 TCTGGAAAGCAGAGGCAGGTTGG - Intergenic
945761385 2:213920105-213920127 TATGGAAAACAGAGAAAAGCAGG - Intronic
946061332 2:216944168-216944190 GCTGCAAAACAGAGAAAGGAAGG + Intergenic
946535618 2:220624826-220624848 ACTGGAAGAAAGAGATAGATAGG + Intergenic
946974284 2:225131166-225131188 TCTGGATGACAGAGCTAGGTTGG + Intergenic
947230334 2:227878151-227878173 TCTGTAACTCAGAGAAAGGTTGG - Intronic
1168981519 20:2008020-2008042 ACTGGAAAACTCAAATAGGTGGG + Intergenic
1169287484 20:4321723-4321745 TCTGGAAAACAGGCATAGAGAGG + Intergenic
1170925958 20:20723936-20723958 TCTGGAAAACAGAGACATTAGGG - Intergenic
1171849561 20:30298464-30298486 TTTGCAAAACACAGATAAGTAGG - Intergenic
1174897529 20:54466802-54466824 TCTGGAAAACAGAGATAAATGGG - Intergenic
1176812039 21:13550884-13550906 TCTGGAAAACACACATCTGTAGG - Intergenic
1176943591 21:14953198-14953220 TTTGGTAATCAGAGATAAGTAGG + Intergenic
1178272329 21:31202739-31202761 TCTGGAATACTGAGCTAAGTAGG + Intronic
1178566594 21:33692088-33692110 TTTGTAAAACTGAGTTAGGTAGG + Intronic
1178682105 21:34680951-34680973 ACTGGAAAACAGACAGAGGTTGG - Intronic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1180466733 22:15618063-15618085 TCTGGAAAACAAAGTTGGGTTGG - Intergenic
1183868049 22:40719822-40719844 CCTGGAAAACAAATACAGGTGGG - Intergenic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184654802 22:45935658-45935680 TTTGGGAAACAGCGATGGGTGGG - Intronic
1185148602 22:49152112-49152134 GTTGGAAGACAGAGATAGCTTGG + Intergenic
949153345 3:797877-797899 CAAGTAAAACAGAGATAGGTAGG - Intergenic
950332566 3:12168195-12168217 TCTGGAAAACAGATAGAGGAGGG + Intronic
951251077 3:20394982-20395004 GATGGAAAACAGAGATCAGTAGG - Intergenic
951337526 3:21442946-21442968 TCTGGAAACCAGAGAAAGAGTGG + Intronic
954948611 3:54448739-54448761 TCTGGACAATAGAGACAGCTGGG - Intronic
955474969 3:59327083-59327105 TCTGCAAAACAGAGAAACATGGG - Intergenic
955547961 3:60051899-60051921 TCTGTGAAACAAAGATTGGTTGG + Intronic
955683394 3:61526001-61526023 TCTTTAAAACAGAGGTAGGCTGG - Intergenic
955942166 3:64156999-64157021 TCTAGAAACCAGGGATGGGTGGG + Intronic
956274319 3:67481742-67481764 TCTTTAAAGCAGAGAAAGGTAGG - Intronic
956293600 3:67688290-67688312 TCTGGAAAAAACACATAGTTGGG + Intergenic
956583039 3:70835137-70835159 TTTGGAGAACAGAGACAGATAGG + Intergenic
957680148 3:83423399-83423421 TGTGGAAAGGAGAAATAGGTTGG + Intergenic
958812415 3:98876873-98876895 TCCAGAAAACACTGATAGGTAGG + Intronic
959221762 3:103530341-103530363 TTTGGAAAAGAGATCTAGGTTGG + Intergenic
959390020 3:105761784-105761806 ACTGGATAACAGGGAGAGGTTGG + Intronic
960254832 3:115500967-115500989 TCTGGAAAACAGTGGGAGGAAGG + Intergenic
960500360 3:118430472-118430494 TCTGGATATCAGAGATTTGTTGG + Intergenic
960500441 3:118431256-118431278 TCTGGATATCAGAGATTTGTTGG + Intergenic
963019175 3:140855858-140855880 TATGGAAAACACAGAGAGGCAGG - Intergenic
963355963 3:144209139-144209161 TCTGGAGAACAGACATGGGATGG - Intergenic
963390436 3:144656819-144656841 TTTGCAAAACAGACATTGGTAGG - Intergenic
963446950 3:145424456-145424478 TTAGGGAAACAGAGATGGGTTGG - Intergenic
963680093 3:148363507-148363529 AATGGGAAACAGTGATAGGTTGG - Intergenic
964194134 3:154042656-154042678 CTTAGAAGACAGAGATAGGTTGG - Intergenic
964534628 3:157706199-157706221 TTTGGAAATCAGAAATAGCTAGG + Intergenic
966058926 3:175732330-175732352 TCTGTAAAGCAGAGAGAGATGGG + Intronic
966978314 3:185106056-185106078 TCTGGAAAAGAAAGATATGGAGG - Intronic
967823860 3:193863069-193863091 TCTGGAAAAACGAGACAGGCTGG - Intergenic
968812684 4:2807116-2807138 GCTGCAAAACAGAGAAAGGCTGG - Intronic
969467337 4:7365575-7365597 TGTGTAAAACAGAGACACGTGGG + Intronic
969567069 4:7984893-7984915 TCTGGAAGAGAAAGAGAGGTTGG + Exonic
969931090 4:10631364-10631386 GCTGGAAACCAGAGATAGGTGGG + Intronic
971196472 4:24475213-24475235 TCTGGAAGAAAGAGGTAGGTGGG - Intergenic
972866253 4:43236783-43236805 TCTAAAAAGCAGAGATATGTTGG - Intergenic
975370265 4:73577973-73577995 TCTGGAAAACAGAGATAGGTGGG - Intronic
976575004 4:86658669-86658691 TCTGGAACTCAGAGGTATGTTGG - Intronic
976623771 4:87156354-87156376 CCTGGACAACACAGAGAGGTGGG + Intergenic
978363187 4:107952560-107952582 TCTGGAAAACAGAGCAAAGAAGG - Exonic
979139304 4:117152114-117152136 ACTGGGAAACAAAGAGAGGTTGG - Intergenic
979677246 4:123423417-123423439 TCTGGAATACAGAGCTAGGAGGG - Intergenic
979874210 4:125866808-125866830 TCTTGAAGACAGATATAGTTGGG - Intergenic
980625231 4:135366187-135366209 TTTGGTAAACAGAGATAGTTTGG - Intergenic
981008016 4:139895632-139895654 TCTTCAAAACACAAATAGGTAGG + Intronic
981084221 4:140666632-140666654 TTTGGAAAATAGATATAGGCTGG - Intronic
982461633 4:155676786-155676808 ACTGGAAAACAAAAAAAGGTTGG - Intronic
982521094 4:156417515-156417537 ACTGGAGAACAGACAGAGGTTGG - Intergenic
984961524 4:185102209-185102231 TCCGGAAAGCAGAGAAAGTTGGG + Intergenic
985955815 5:3265424-3265446 GCTGGAAAACAGAGGTGGGCTGG - Intergenic
986894262 5:12346721-12346743 ACTGGATAACAGAAAAAGGTTGG + Intergenic
989129859 5:38096489-38096511 TCAGGCAAACAGAGGTAGGAAGG + Intergenic
989197664 5:38731602-38731624 CCTGGAAAACTGACATAGGATGG + Intergenic
989527423 5:42469114-42469136 TCTGGGAAAGAGAGACAGTTTGG + Intronic
989656874 5:43754224-43754246 ACTGGATAACAGACAGAGGTTGG - Intergenic
990522874 5:56596388-56596410 TCTGGAAAACACTCATAGCTGGG - Intronic
990613794 5:57486617-57486639 TCTGGAAAAGAGAGATAAAATGG + Intergenic
991518755 5:67470188-67470210 TCTGGAAAAAAGAGTTTGGCAGG - Intergenic
992649050 5:78839256-78839278 TCAGGAAAAAAGAGAAAGCTAGG + Intronic
993610855 5:90052661-90052683 ACTGGCAAAGAGAGATAGGGAGG - Intergenic
994001732 5:94789183-94789205 TCTGGAGAACTGAGCAAGGTGGG + Intronic
994349578 5:98729122-98729144 TCTGTAAAATACAGATGGGTTGG - Intergenic
994428837 5:99628997-99629019 TCAGGAATACAGAAATAGGATGG - Intergenic
994872409 5:105368937-105368959 TCAGGAAAACAAAAATAGCTGGG + Intergenic
995795198 5:115933885-115933907 TCATCAAACCAGAGATAGGTAGG - Intergenic
996167982 5:120249942-120249964 TCAGGAAAATAGAGAGAGGTGGG + Intergenic
998578731 5:143347062-143347084 TCTAGAAAAGAGAGACAGGCAGG - Intronic
1000171018 5:158703231-158703253 TCTGGAAAACAGACACAGTTAGG + Intronic
1001691772 5:173638704-173638726 GCTGGAAGGCAGAAATAGGTGGG + Intergenic
1002313218 5:178327410-178327432 TCTGGGAGACAGGGAGAGGTGGG - Intronic
1002435413 5:179228138-179228160 TCTGGAGCACAGAGAGAGGGTGG + Intronic
1002586639 5:180252882-180252904 TCTGGAAGACAGAGGTTAGTGGG - Intronic
1003393552 6:5733694-5733716 TGAGGAAAACCCAGATAGGTGGG - Intronic
1004108272 6:12686992-12687014 GCTGTAAAACAGACATAAGTAGG + Intergenic
1004330374 6:14715504-14715526 TCTGGAAAAGAGAGAAAGGCAGG + Intergenic
1004805805 6:19202411-19202433 ACTGGATAACAGACAGAGGTTGG - Intergenic
1005231802 6:23710324-23710346 TCAGCAAAACAGAGAAAGGATGG + Intergenic
1005597797 6:27395842-27395864 TCTGGAGAAGAGAGATTGTTAGG - Intronic
1005673334 6:28129055-28129077 ACTGGAGAACAGAGATGGGGAGG - Intronic
1007643817 6:43365287-43365309 TCTGGAAGACATGGACAGGTAGG - Exonic
1008667631 6:53731874-53731896 TCTGGACAACAGGGAAAGGTAGG - Intergenic
1010208739 6:73346346-73346368 TCAGGAAAGCTGAGATAGGTGGG - Intergenic
1010869040 6:81015887-81015909 GATGGAAAACAAAAATAGGTAGG - Intergenic
1011876175 6:91965241-91965263 ACTGGATAACAGACAGAGGTTGG + Intergenic
1013358854 6:109374472-109374494 TCTAGAGAACAGATAGAGGTGGG - Intronic
1013628833 6:111965056-111965078 TCTGGAAAAGAGAGAGAGTCAGG + Intergenic
1015722447 6:136257124-136257146 TCTTGAAAATAGAAAAAGGTTGG - Exonic
1015814491 6:137194024-137194046 TCTGGTAACCAGAAATAAGTAGG + Intergenic
1017274439 6:152549481-152549503 TATGGAAAACAGAGTGAGGGAGG - Intronic
1021801366 7:24310007-24310029 GCTTGAAAACAGAGACAGGCTGG + Intergenic
1023487747 7:40704729-40704751 TCTGGAACACAGTGTTAGTTGGG - Intronic
1023572472 7:41586567-41586589 TCTGGTAAAAACATATAGGTGGG - Intergenic
1023794860 7:43783224-43783246 GCTGGGAAACAGGGATAGGAGGG - Intronic
1024142535 7:46476907-46476929 TCTCAAACACAGAAATAGGTTGG + Intergenic
1026542895 7:71296199-71296221 TCTGATAAATAGAGATAGATAGG - Intronic
1027649019 7:80841564-80841586 ACTGGAAAACAGCTATATGTTGG + Intronic
1028041105 7:86056084-86056106 TCTTGAAGACAGAGATGGGTGGG + Intergenic
1029209977 7:98899400-98899422 GCTGGAAGACAGAAATGGGTAGG - Exonic
1029235103 7:99109062-99109084 TCTGGAAAACCTAGGTAAGTTGG - Intronic
1030799562 7:113832897-113832919 TCCAGAAAACAGAAATAGTTAGG - Intergenic
1031580296 7:123466472-123466494 CTTGAAAGACAGAGATAGGTAGG - Intronic
1031975839 7:128093062-128093084 TCCGGAGAACAGAGCTAGGAGGG + Intergenic
1032348516 7:131139112-131139134 CCTGGAATACAGGGATAGGATGG + Intronic
1032722151 7:134558976-134558998 TCTGGACAACAGAAAGAGGATGG + Intronic
1033412542 7:141132190-141132212 CCTGCCAAACAAAGATAGGTAGG - Intronic
1034380926 7:150691696-150691718 TCTGGAGATCAGAGATGCGTAGG - Intronic
1037133685 8:15437326-15437348 TGTAGTAAACAGAGATATGTAGG - Intronic
1037875201 8:22542318-22542340 ATAGGAAAACAGAGATAGATGGG - Intergenic
1038597243 8:28899009-28899031 TGTGGGATACAAAGATAGGTTGG + Intronic
1038758111 8:30360724-30360746 TCTGTAAAAAAGAGATACATGGG + Intergenic
1039066387 8:33612149-33612171 TCTGGAAAGGAGAGAGAGGTTGG + Intergenic
1039225710 8:35385763-35385785 TCTGTTAAAAAGAGGTAGGTAGG - Intronic
1039721690 8:40171217-40171239 TCTGCAAAACAGAGCTATTTTGG - Intergenic
1040000622 8:42573331-42573353 TCTGAAAAACAGGGATATGAAGG - Intergenic
1040528922 8:48249572-48249594 TCTGGAAAAAAAAGATCTGTAGG + Intergenic
1041033437 8:53761769-53761791 TCTAAACAACAGAGATAGGTGGG + Intronic
1042072093 8:64947446-64947468 ACTGAAACACAGAGATAGTTTGG + Intergenic
1043721743 8:83553456-83553478 ACTGGATAACAGACAAAGGTTGG - Intergenic
1044697168 8:94935073-94935095 TCTGGAAAACAGGAAACGGTAGG + Intronic
1046687570 8:117244397-117244419 TATGGCAAAGAGAGATATGTTGG + Intergenic
1050703937 9:8373921-8373943 ACTAGAAAACTGAGATAGGTAGG - Intronic
1051128265 9:13830389-13830411 ACTGTAAAACAGCCATAGGTTGG - Intergenic
1053243145 9:36513189-36513211 TCTGGAAAAAAAAAAGAGGTGGG + Intergenic
1053787339 9:41661758-41661780 TTTGCAAAACACAGATAAGTAGG - Intergenic
1054157788 9:61653009-61653031 TTTGCAAAACACAGATAAGTAGG + Intergenic
1054175616 9:61873097-61873119 TTTGCAAAACACAGATAAGTAGG - Intergenic
1054477562 9:65584014-65584036 TTTGCAAAACACAGATAAGTAGG + Intergenic
1054661923 9:67707713-67707735 TTTGCAAAACACAGATAAGTAGG + Intergenic
1054972462 9:71104555-71104577 TCTGAAAACCAGAGATAAGAAGG + Intronic
1055736787 9:79338711-79338733 ACTGCAAAACAGAGGTAGGCAGG - Intergenic
1061678957 9:132233112-132233134 TCTGGACTTCAGACATAGGTTGG + Intronic
1061697281 9:132386160-132386182 ACTGGAAAACTGAAATAGGAGGG + Intronic
1185615752 X:1420793-1420815 TCTGAAAAATAGAAATAGGAAGG - Intronic
1186880772 X:13864025-13864047 TGTGGAAAGCAGTGAGAGGTTGG + Intronic
1187241970 X:17522084-17522106 CTTGGAAGACAGAGACAGGTAGG + Intronic
1188263339 X:28042064-28042086 CCTGGAAAACAGAGGTTCGTAGG - Intergenic
1188336619 X:28943119-28943141 TCTGGAATAAAGAGATAAATAGG - Intronic
1188799493 X:34510250-34510272 TGTGGACAACAGAGATATGGAGG - Intergenic
1189213215 X:39302039-39302061 ACTGGAAAACAGGCAGAGGTTGG + Intergenic
1189997192 X:46650380-46650402 TCTGGAATATAGACATAGTTTGG - Intronic
1190237723 X:48630300-48630322 TTTTGAAAATAGAGACAGGTGGG + Intergenic
1191987503 X:66998051-66998073 TCTGTAAAACACAGATAGGATGG + Intergenic
1193865164 X:86721613-86721635 TCTGGGTAACAGACAGAGGTTGG - Intronic
1194804306 X:98308433-98308455 CTTGGAAAACAGAAAAAGGTAGG + Intergenic
1194905856 X:99575699-99575721 ACTGGGTAACAGACATAGGTTGG + Intergenic
1194962575 X:100252380-100252402 AATGGAAAACAGAAACAGGTAGG + Intergenic
1196199160 X:112865997-112866019 TCTTGAAAACAGGGAGGGGTGGG + Intergenic
1197421698 X:126243434-126243456 TCTGGAACATGGAGAAAGGTGGG + Intergenic
1197836174 X:130696112-130696134 TCTGGCAAACTGGGATTGGTGGG + Intronic
1198471212 X:136948837-136948859 TCTGGGAAACTGGGGTAGGTGGG - Intergenic
1199829683 X:151537242-151537264 CCTAGTAAACAGACATAGGTGGG + Intergenic
1200278727 X:154758655-154758677 TCTGGAAAACAGAGTTGAGGTGG + Intergenic