ID: 975373693

View in Genome Browser
Species Human (GRCh38)
Location 4:73617591-73617613
Sequence GCCTAGTAAAGGAGCTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975373693 Original CRISPR GCCTAGTAAAGGAGCTTAAG AGG (reversed) Intronic
905953356 1:41971858-41971880 GCCTTGTAAAAGGGCTTGAGGGG + Intronic
907777425 1:57531590-57531612 GACCAGTAAGGGAGCTGAAGTGG + Intronic
908421314 1:63961142-63961164 TAATATTAAAGGAGCTTAAGGGG - Intronic
915789310 1:158650838-158650860 GCCTGGTACAGAAGATTAAGAGG + Intronic
917800154 1:178562752-178562774 GCCTAGGAAAGGAGGAGAAGGGG - Intergenic
1076579721 10:131499239-131499261 GCCTGGTCAATGTGCTTAAGAGG - Intergenic
1085678651 11:78549706-78549728 TGCAAGTAATGGAGCTTAAGAGG + Intronic
1090518408 11:127452669-127452691 ACCTAGTAATGGATCTTATGTGG + Intergenic
1092924024 12:13257750-13257772 GCCTATTGAGGGGGCTTAAGGGG + Intergenic
1093017761 12:14171711-14171733 ACCTACTAAAGGATTTTAAGTGG + Intergenic
1093266895 12:17015065-17015087 GCCTGGCAGAGGAGCTGAAGTGG - Intergenic
1093282655 12:17213975-17213997 GGCTACTAAAAGAGATTAAGAGG - Intergenic
1094439630 12:30460610-30460632 GCCTAGGAGAAGAGCTCAAGAGG - Intergenic
1097634171 12:62102043-62102065 GCCTAGTTAAGAAGCTGAGGTGG + Intronic
1100796046 12:98182850-98182872 GCCCAGTAAAAGAGTTTAAGAGG - Intergenic
1104424360 12:128662876-128662898 GCCTAGTAAAGCAACTTTGGGGG - Intronic
1106323492 13:28664736-28664758 GCATAGAAAGGGAGCTTTAGAGG - Intronic
1111054693 13:82933497-82933519 GTCTAGAAAAGTAGCTTGAGAGG - Intergenic
1114616824 14:24072824-24072846 GTCTAGGGAAGGAGGTTAAGGGG + Intronic
1126603484 15:50452303-50452325 TCCTAGTAAAAGGGATTAAGTGG + Intronic
1127084036 15:55408207-55408229 GCCTAGTACAGTACCTGAAGGGG + Exonic
1132917766 16:2362552-2362574 GCCTAGGAAAGCAGCTAAATCGG + Intergenic
1133935087 16:10262707-10262729 ACCTAGTAAAGGACATGAAGAGG + Intergenic
1136781521 16:32905407-32905429 CCCTAGGGAAGGAGCTGAAGTGG + Intergenic
1137753187 16:50881631-50881653 GCCTAGGAAAGAAGCCTCAGAGG - Intergenic
1150294840 17:64002126-64002148 GCCTAGTAATGGAGCAAGAGGGG + Exonic
1157470481 18:47984386-47984408 GCCTAGTAAAGGGGCTCTGGTGG - Intergenic
1157636803 18:49165247-49165269 GCCTAATAAAAGAACTTCAGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
931966561 2:67542598-67542620 GCCTGGTAATGGAGCTGAGGTGG - Intergenic
933173755 2:79155107-79155129 GACTAGTAACTGACCTTAAGGGG - Intergenic
935056665 2:99573510-99573532 GCCTACTCAAGGATCTTAATTGG + Intronic
937522693 2:122731703-122731725 GCCCAGTAAAGGAGCCTCTGAGG - Intergenic
940012044 2:149064917-149064939 GCCTGGTACAGGAGTTTGAGTGG + Intronic
948283165 2:236764233-236764255 GCCTAGCAAAGGTGCTTAAGGGG + Intergenic
948843095 2:240668042-240668064 GCCTAATAGAGGAGCTAAATTGG + Intergenic
1176694434 21:9958096-9958118 GCCTGGCAAGGGAGCTGAAGTGG - Intergenic
1177907255 21:26986981-26987003 GGCTAGTAATGAAGTTTAAGAGG - Intergenic
1179362320 21:40722989-40723011 ACCTAATAAAAGAGCTTCAGAGG + Intronic
1180729200 22:17968766-17968788 GCATACTAAAGGAGCTCGAGGGG + Intronic
1184922982 22:47618701-47618723 TCCTTGGAAAGGAGCTCAAGTGG - Intergenic
949315111 3:2744785-2744807 GCCCAGTAAAGCAGGTTTAGTGG - Intronic
952257784 3:31710447-31710469 GCCTAGGAGAGGAGCTTGGGTGG - Intronic
952464085 3:33562619-33562641 TCCTAGTAAATGAGCTTTGGGGG - Intronic
953556779 3:43952324-43952346 GCCTGGGAAAGGAGCAGAAGGGG + Intergenic
956388317 3:68744639-68744661 ACCTAGAAAAGGAGCTGGAGGGG + Intronic
957503578 3:81090693-81090715 GCTTAGTCAAGGACATTAAGTGG - Intergenic
957657102 3:83094319-83094341 GGCTAGTAACAGATCTTAAGAGG - Intergenic
961090538 3:124107519-124107541 GCCTAGAAAAGAAGCTCTAGGGG - Intronic
962144777 3:132829436-132829458 GCCAAGGAAAGGAGCTGCAGAGG - Intergenic
962530528 3:136276398-136276420 GCCTGGCAAAGGAGCTGAGGTGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965729902 3:171760730-171760752 GCCTAGGATGGGAGCTTAAGGGG + Intronic
967800073 3:193647513-193647535 GCCAAGTAAAGGAAGTTCAGAGG - Intronic
975373693 4:73617591-73617613 GCCTAGTAAAGGAGCTTAAGAGG - Intronic
978027633 4:103896961-103896983 GACTAGTAGAGGAGCTAATGTGG + Intergenic
980367058 4:131818322-131818344 GCCTGGCAAGGGAGCTGAAGTGG - Intergenic
981016472 4:139979300-139979322 GCCATGTAAAAGAGCTAAAGAGG - Intronic
983810932 4:172061448-172061470 GACAAATAAAGGAGCTTGAGGGG - Intronic
991477818 5:67042189-67042211 GCCTAAGAAGGGAGGTTAAGTGG - Intronic
993667857 5:90722930-90722952 GCCTAGCAAAGGAGACTTAGGGG + Intronic
994580063 5:101630065-101630087 CCCAAGTAAAGGAGTATAAGAGG + Intergenic
995664158 5:114522486-114522508 GCCTAGTAAAGGGGTTGGAGAGG - Intergenic
998487747 5:142517662-142517684 GCCTATGAAAGCAGCTTGAGGGG + Intergenic
999714482 5:154349160-154349182 GCCTAGTAAAGGAGGTTCCTTGG + Intronic
1000695267 5:164372979-164373001 GGGTAGTAAAGTAGCCTAAGTGG - Intergenic
1002953297 6:1837575-1837597 GCCTAGTAAAGGAAGTTACTGGG + Intronic
1003064750 6:2894503-2894525 TCAAACTAAAGGAGCTTAAGTGG + Intronic
1008882584 6:56395592-56395614 GCCCAGTAGGGGAGCTGAAGTGG + Intergenic
1009314915 6:62206003-62206025 GCTTGCTGAAGGAGCTTAAGAGG + Intronic
1018688826 6:166326690-166326712 GCCTAGTAATGGTGGTGAAGAGG - Intronic
1028862973 7:95675402-95675424 GCAGAGTCAAGGAGCTTGAGTGG - Intergenic
1033221038 7:139526217-139526239 GCCTGGGAAAGGAGCCTGAGAGG + Intronic
1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG + Intergenic
1044674293 8:94714200-94714222 GCCTAGTAAATGATCTGCAGTGG + Intergenic
1047715131 8:127588310-127588332 GCCTAGTAGAGTAGGCTAAGGGG + Intergenic
1048199420 8:132359459-132359481 CCCAAGCAGAGGAGCTTAAGAGG - Intronic
1053308565 9:37001120-37001142 ACCTTGTAAAGGAGCTTGAGGGG + Intronic
1053631405 9:39944037-39944059 GCCTGGCAAGGGAGCTGAAGTGG - Intergenic
1053774360 9:41519494-41519516 GCCTGGCAAGGGAGCTGAAGTGG + Intergenic
1054212482 9:62306661-62306683 GCCTGGCAAGGGAGCTGAAGTGG + Intergenic
1061998652 9:134204524-134204546 GACAAGCAAAGGCGCTTAAGAGG + Intergenic
1185948972 X:4409284-4409306 GGCTATTTAAGGACCTTAAGTGG - Intergenic
1189853343 X:45198776-45198798 GCCTAGGAAAAGAGATAAAGAGG - Intronic
1195724297 X:107898395-107898417 AGCTAGAAATGGAGCTTAAGGGG - Intronic
1197392048 X:125879022-125879044 GACTAGTAAAGGATATTAAAAGG - Intergenic
1197394255 X:125907080-125907102 GCCTGGTAGAGGAGCTAAAGTGG - Intergenic