ID: 975373934

View in Genome Browser
Species Human (GRCh38)
Location 4:73620458-73620480
Sequence CGCCGCCCCTGCGCCCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975373934_975373940 9 Left 975373934 4:73620458-73620480 CCCGCGCGGGCGCAGGGGCGGCG 0: 1
1: 0
2: 3
3: 63
4: 383
Right 975373940 4:73620490-73620512 TCCCAGAGCATGGCTCAGCTGGG 0: 1
1: 0
2: 4
3: 25
4: 247
975373934_975373939 8 Left 975373934 4:73620458-73620480 CCCGCGCGGGCGCAGGGGCGGCG 0: 1
1: 0
2: 3
3: 63
4: 383
Right 975373939 4:73620489-73620511 CTCCCAGAGCATGGCTCAGCTGG 0: 1
1: 0
2: 3
3: 36
4: 252
975373934_975373936 -1 Left 975373934 4:73620458-73620480 CCCGCGCGGGCGCAGGGGCGGCG 0: 1
1: 0
2: 3
3: 63
4: 383
Right 975373936 4:73620480-73620502 GCCTGTCTCCTCCCAGAGCATGG 0: 1
1: 0
2: 2
3: 49
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975373934 Original CRISPR CGCCGCCCCTGCGCCCGCGC GGG (reversed) Exonic