ID: 975373984

View in Genome Browser
Species Human (GRCh38)
Location 4:73620921-73620943
Sequence GGGTGAAAAAAAGTGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975373984_975373989 10 Left 975373984 4:73620921-73620943 CCTGCTAGCACTTTTTTTCACCC No data
Right 975373989 4:73620954-73620976 TTCGCGCTTCAGGGTGCACCAGG 0: 1
1: 0
2: 0
3: 0
4: 52
975373984_975373987 0 Left 975373984 4:73620921-73620943 CCTGCTAGCACTTTTTTTCACCC No data
Right 975373987 4:73620944-73620966 AGAGCAGCGTTTCGCGCTTCAGG No data
975373984_975373988 1 Left 975373984 4:73620921-73620943 CCTGCTAGCACTTTTTTTCACCC No data
Right 975373988 4:73620945-73620967 GAGCAGCGTTTCGCGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975373984 Original CRISPR GGGTGAAAAAAAGTGCTAGC AGG (reversed) Intergenic
No off target data available for this crispr