ID: 975374954

View in Genome Browser
Species Human (GRCh38)
Location 4:73632478-73632500
Sequence ATTCTTTTGTCCCATGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975374954_975374960 20 Left 975374954 4:73632478-73632500 CCCCATGCATGGGACAAAAGAAT No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data
975374954_975374961 21 Left 975374954 4:73632478-73632500 CCCCATGCATGGGACAAAAGAAT No data
Right 975374961 4:73632522-73632544 TCCCAGAACTTTCTGTGGATGGG No data
975374954_975374959 16 Left 975374954 4:73632478-73632500 CCCCATGCATGGGACAAAAGAAT No data
Right 975374959 4:73632517-73632539 TTGAGTCCCAGAACTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975374954 Original CRISPR ATTCTTTTGTCCCATGCATG GGG (reversed) Intergenic
No off target data available for this crispr