ID: 975374956

View in Genome Browser
Species Human (GRCh38)
Location 4:73632480-73632502
Sequence GGATTCTTTTGTCCCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975374956_975374961 19 Left 975374956 4:73632480-73632502 CCATGCATGGGACAAAAGAATCC No data
Right 975374961 4:73632522-73632544 TCCCAGAACTTTCTGTGGATGGG No data
975374956_975374960 18 Left 975374956 4:73632480-73632502 CCATGCATGGGACAAAAGAATCC No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data
975374956_975374959 14 Left 975374956 4:73632480-73632502 CCATGCATGGGACAAAAGAATCC No data
Right 975374959 4:73632517-73632539 TTGAGTCCCAGAACTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975374956 Original CRISPR GGATTCTTTTGTCCCATGCA TGG (reversed) Intergenic
No off target data available for this crispr