ID: 975374958

View in Genome Browser
Species Human (GRCh38)
Location 4:73632501-73632523
Sequence GACTCAAAAAGCCTGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975374958_975374960 -3 Left 975374958 4:73632501-73632523 CCAGATAACAGGCTTTTTGAGTC No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data
975374958_975374964 17 Left 975374958 4:73632501-73632523 CCAGATAACAGGCTTTTTGAGTC No data
Right 975374964 4:73632541-73632563 TGGGAAATTGCTTTCAGCAGAGG No data
975374958_975374961 -2 Left 975374958 4:73632501-73632523 CCAGATAACAGGCTTTTTGAGTC No data
Right 975374961 4:73632522-73632544 TCCCAGAACTTTCTGTGGATGGG No data
975374958_975374965 23 Left 975374958 4:73632501-73632523 CCAGATAACAGGCTTTTTGAGTC No data
Right 975374965 4:73632547-73632569 ATTGCTTTCAGCAGAGGAACAGG No data
975374958_975374959 -7 Left 975374958 4:73632501-73632523 CCAGATAACAGGCTTTTTGAGTC No data
Right 975374959 4:73632517-73632539 TTGAGTCCCAGAACTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975374958 Original CRISPR GACTCAAAAAGCCTGTTATC TGG (reversed) Intergenic
No off target data available for this crispr