ID: 975374960

View in Genome Browser
Species Human (GRCh38)
Location 4:73632521-73632543
Sequence GTCCCAGAACTTTCTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975374958_975374960 -3 Left 975374958 4:73632501-73632523 CCAGATAACAGGCTTTTTGAGTC No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data
975374955_975374960 19 Left 975374955 4:73632479-73632501 CCCATGCATGGGACAAAAGAATC No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data
975374954_975374960 20 Left 975374954 4:73632478-73632500 CCCCATGCATGGGACAAAAGAAT No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data
975374956_975374960 18 Left 975374956 4:73632480-73632502 CCATGCATGGGACAAAAGAATCC No data
Right 975374960 4:73632521-73632543 GTCCCAGAACTTTCTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975374960 Original CRISPR GTCCCAGAACTTTCTGTGGA TGG Intergenic
No off target data available for this crispr