ID: 975375504

View in Genome Browser
Species Human (GRCh38)
Location 4:73639332-73639354
Sequence GTCATAGTGCCCCCAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975375504_975375507 10 Left 975375504 4:73639332-73639354 CCAAATTTTGGGGGCACTATGAC No data
Right 975375507 4:73639365-73639387 TGTTTAAATAAACTTTATGGAGG No data
975375504_975375506 7 Left 975375504 4:73639332-73639354 CCAAATTTTGGGGGCACTATGAC No data
Right 975375506 4:73639362-73639384 TTCTGTTTAAATAAACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975375504 Original CRISPR GTCATAGTGCCCCCAAAATT TGG (reversed) Intergenic