ID: 975375506

View in Genome Browser
Species Human (GRCh38)
Location 4:73639362-73639384
Sequence TTCTGTTTAAATAAACTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975375504_975375506 7 Left 975375504 4:73639332-73639354 CCAAATTTTGGGGGCACTATGAC No data
Right 975375506 4:73639362-73639384 TTCTGTTTAAATAAACTTTATGG No data
975375503_975375506 8 Left 975375503 4:73639331-73639353 CCCAAATTTTGGGGGCACTATGA No data
Right 975375506 4:73639362-73639384 TTCTGTTTAAATAAACTTTATGG No data
975375498_975375506 27 Left 975375498 4:73639312-73639334 CCAGGAATCTTGAGTAGTTCCCA No data
Right 975375506 4:73639362-73639384 TTCTGTTTAAATAAACTTTATGG No data
975375497_975375506 28 Left 975375497 4:73639311-73639333 CCCAGGAATCTTGAGTAGTTCCC No data
Right 975375506 4:73639362-73639384 TTCTGTTTAAATAAACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975375506 Original CRISPR TTCTGTTTAAATAAACTTTA TGG Intergenic