ID: 975375507

View in Genome Browser
Species Human (GRCh38)
Location 4:73639365-73639387
Sequence TGTTTAAATAAACTTTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975375498_975375507 30 Left 975375498 4:73639312-73639334 CCAGGAATCTTGAGTAGTTCCCA No data
Right 975375507 4:73639365-73639387 TGTTTAAATAAACTTTATGGAGG No data
975375504_975375507 10 Left 975375504 4:73639332-73639354 CCAAATTTTGGGGGCACTATGAC No data
Right 975375507 4:73639365-73639387 TGTTTAAATAAACTTTATGGAGG No data
975375503_975375507 11 Left 975375503 4:73639331-73639353 CCCAAATTTTGGGGGCACTATGA No data
Right 975375507 4:73639365-73639387 TGTTTAAATAAACTTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975375507 Original CRISPR TGTTTAAATAAACTTTATGG AGG Intergenic